NUDT3-nudix (nucleoside diphosphate linked moiety X)-type motif 3 Gene View larger

NUDT3-nudix (nucleoside diphosphate linked moiety X)-type motif 3 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NUDT3-nudix (nucleoside diphosphate linked moiety X)-type motif 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NUDT3-nudix (nucleoside diphosphate linked moiety X)-type motif 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007727
Product type: DNA & cDNA
Ncbi symbol: NUDT3
Origin species: Human
Product name: NUDT3-nudix (nucleoside diphosphate linked moiety X)-type motif 3 Gene
Size: 2ug
Accessions: BC007727
Gene id: 11165
Gene description: nudix (nucleoside diphosphate linked moiety X)-type motif 3
Synonyms: DIPP; DIPP-1; DIPP1; diphosphoinositol polyphosphate phosphohydrolase 1; diadenosine 5',5'''-P1,P6-hexaphosphate hydrolase 1; nucleoside diphosphate-linked moiety X motif 3; nudix (nucleoside diphosphate linked moiety X)-type motif 3; nudix motif 3; nudix hydrolase 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgaagctcaagtcgaaccagacccgcacctacgacggcgacggctacaagaagcgggccgcatgcctgtgtttccgcagcgagagcgaggaggaggtgctactcgtgagcagtagtcgccatccagacagatggattgtccctggaggaggcatggagcccgaggaggagccaagtgtggcagcagttcgtgaagtctgtgaggaggctggagtaaaagggacattgggaagattagttggaatttttgagaaccaggagaggaagcacaggacgtatgtctatgtgctcattgtcactgaagtgctggaagactgggaagattcagttaacattggaaggaagagggaatggtttaaaatagaagacgccataaaagtgctgcagtatcacaaacccgtgcaggcatcatattttgaaacattgaggcaaggctactcagccaacaatggcaccccagtcgtggccaccacatactcggtttctgctcagagctcgatgtcaggcatcagatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nudix (nucleoside diphosphate linked moiety X)-type motif 4
- CASP2 and RIPK1 domain containing adaptor with death domain
- oligonucleotide/oligosaccharide-binding fold containing 2A
- platelet-derived growth factor receptor, alpha polypeptide

Buy NUDT3-nudix (nucleoside diphosphate linked moiety X)-type motif 3 Gene now

Add to cart