Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NUDT3-nudix (nucleoside diphosphate linked moiety X)-type motif 3 Gene
PTXBC007727
New product
Data sheet of NUDT3-nudix (nucleoside diphosphate linked moiety X)-type motif 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NUDT3-nudix (nucleoside diphosphate linked moiety X)-type motif 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007727 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NUDT3 |
| Origin species: | Human |
| Product name: | NUDT3-nudix (nucleoside diphosphate linked moiety X)-type motif 3 Gene |
| Size: | 2ug |
| Accessions: | BC007727 |
| Gene id: | 11165 |
| Gene description: | nudix (nucleoside diphosphate linked moiety X)-type motif 3 |
| Synonyms: | DIPP; DIPP-1; DIPP1; diphosphoinositol polyphosphate phosphohydrolase 1; diadenosine 5',5'''-P1,P6-hexaphosphate hydrolase 1; nucleoside diphosphate-linked moiety X motif 3; nudix (nucleoside diphosphate linked moiety X)-type motif 3; nudix motif 3; nudix hydrolase 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatgaagctcaagtcgaaccagacccgcacctacgacggcgacggctacaagaagcgggccgcatgcctgtgtttccgcagcgagagcgaggaggaggtgctactcgtgagcagtagtcgccatccagacagatggattgtccctggaggaggcatggagcccgaggaggagccaagtgtggcagcagttcgtgaagtctgtgaggaggctggagtaaaagggacattgggaagattagttggaatttttgagaaccaggagaggaagcacaggacgtatgtctatgtgctcattgtcactgaagtgctggaagactgggaagattcagttaacattggaaggaagagggaatggtttaaaatagaagacgccataaaagtgctgcagtatcacaaacccgtgcaggcatcatattttgaaacattgaggcaaggctactcagccaacaatggcaccccagtcgtggccaccacatactcggtttctgctcagagctcgatgtcaggcatcagatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nudix (nucleoside diphosphate linked moiety X)-type motif 4 - CASP2 and RIPK1 domain containing adaptor with death domain - oligonucleotide/oligosaccharide-binding fold containing 2A - platelet-derived growth factor receptor, alpha polypeptide |