Login to display prices
Login to display prices
NUDT4-nudix (nucleoside diphosphate linked moiety X)-type motif 4 Gene View larger

NUDT4-nudix (nucleoside diphosphate linked moiety X)-type motif 4 Gene

PTXBC012069

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NUDT4-nudix (nucleoside diphosphate linked moiety X)-type motif 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NUDT4-nudix (nucleoside diphosphate linked moiety X)-type motif 4 Gene

Proteogenix catalog: PTXBC012069
Ncbi symbol: NUDT4
Product name: NUDT4-nudix (nucleoside diphosphate linked moiety X)-type motif 4 Gene
Size: 2ug
Accessions: BC012069
Gene id: 11163
Gene description: nudix (nucleoside diphosphate linked moiety X)-type motif 4
Synonyms: DIPP2; DIPP2alpha; DIPP2beta; HDCMB47P; diphosphoinositol polyphosphate phosphohydrolase 2; DIPP-2; diadenosine 5',5'''-P1,P6-hexaphosphate hydrolase 2; nudix (nucleoside diphosphate linked moiety X)-type motif 4; nudix hydrolase 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgaagttcaagcccaaccagacgcggacctacgaccgcgagggcttcaagaagcgggcggcgtgcctgtgcttccggagcgagcaggaggacgaggtgctgctggtgagtagcagccggtacccagaccagtggattgtcccaggaggaggaatggaacccgaggaggaacctggcggtgctgccgtgagggaagtttatgaggaggctggagtcaaaggaaaactaggcagacttctgggcatatttgagcagaaccaagaccgaaagcacagaacatatgtttatgttctaacagtcactgaaatattagaagattgggaagattctgttaatattggaaggaagagagagtggttcaaagtagaagatgctatcaaagttctccagtgtcataaacctgtacatgcagagtatctggaaaagctaaagctgggttgttccccagccaatggaaattctacagtcccttcccttccggataataatgccttgtttgtaaccgctgcacagacctctgggttgccatctagtgtaagatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice