NUDT4-nudix (nucleoside diphosphate linked moiety X)-type motif 4 Gene View larger

NUDT4-nudix (nucleoside diphosphate linked moiety X)-type motif 4 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NUDT4-nudix (nucleoside diphosphate linked moiety X)-type motif 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NUDT4-nudix (nucleoside diphosphate linked moiety X)-type motif 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012069
Product type: DNA & cDNA
Ncbi symbol: NUDT4
Origin species: Human
Product name: NUDT4-nudix (nucleoside diphosphate linked moiety X)-type motif 4 Gene
Size: 2ug
Accessions: BC012069
Gene id: 11163
Gene description: nudix (nucleoside diphosphate linked moiety X)-type motif 4
Synonyms: DIPP2; DIPP2alpha; DIPP2beta; HDCMB47P; diphosphoinositol polyphosphate phosphohydrolase 2; DIPP-2; diadenosine 5',5'''-P1,P6-hexaphosphate hydrolase 2; nudix (nucleoside diphosphate linked moiety X)-type motif 4; nudix hydrolase 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgaagttcaagcccaaccagacgcggacctacgaccgcgagggcttcaagaagcgggcggcgtgcctgtgcttccggagcgagcaggaggacgaggtgctgctggtgagtagcagccggtacccagaccagtggattgtcccaggaggaggaatggaacccgaggaggaacctggcggtgctgccgtgagggaagtttatgaggaggctggagtcaaaggaaaactaggcagacttctgggcatatttgagcagaaccaagaccgaaagcacagaacatatgtttatgttctaacagtcactgaaatattagaagattgggaagattctgttaatattggaaggaagagagagtggttcaaagtagaagatgctatcaaagttctccagtgtcataaacctgtacatgcagagtatctggaaaagctaaagctgggttgttccccagccaatggaaattctacagtcccttcccttccggataataatgccttgtttgtaaccgctgcacagacctctgggttgccatctagtgtaagatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CASP2 and RIPK1 domain containing adaptor with death domain
- oligonucleotide/oligosaccharide-binding fold containing 2A
- platelet-derived growth factor receptor, alpha polypeptide
- proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane)

Buy NUDT4-nudix (nucleoside diphosphate linked moiety X)-type motif 4 Gene now

Add to cart