Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NUDT4-nudix (nucleoside diphosphate linked moiety X)-type motif 4 Gene
PTXBC012069
New product
Data sheet of NUDT4-nudix (nucleoside diphosphate linked moiety X)-type motif 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NUDT4-nudix (nucleoside diphosphate linked moiety X)-type motif 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012069 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NUDT4 |
| Origin species: | Human |
| Product name: | NUDT4-nudix (nucleoside diphosphate linked moiety X)-type motif 4 Gene |
| Size: | 2ug |
| Accessions: | BC012069 |
| Gene id: | 11163 |
| Gene description: | nudix (nucleoside diphosphate linked moiety X)-type motif 4 |
| Synonyms: | DIPP2; DIPP2alpha; DIPP2beta; HDCMB47P; diphosphoinositol polyphosphate phosphohydrolase 2; DIPP-2; diadenosine 5',5'''-P1,P6-hexaphosphate hydrolase 2; nudix (nucleoside diphosphate linked moiety X)-type motif 4; nudix hydrolase 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatgaagttcaagcccaaccagacgcggacctacgaccgcgagggcttcaagaagcgggcggcgtgcctgtgcttccggagcgagcaggaggacgaggtgctgctggtgagtagcagccggtacccagaccagtggattgtcccaggaggaggaatggaacccgaggaggaacctggcggtgctgccgtgagggaagtttatgaggaggctggagtcaaaggaaaactaggcagacttctgggcatatttgagcagaaccaagaccgaaagcacagaacatatgtttatgttctaacagtcactgaaatattagaagattgggaagattctgttaatattggaaggaagagagagtggttcaaagtagaagatgctatcaaagttctccagtgtcataaacctgtacatgcagagtatctggaaaagctaaagctgggttgttccccagccaatggaaattctacagtcccttcccttccggataataatgccttgtttgtaaccgctgcacagacctctgggttgccatctagtgtaagatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - CASP2 and RIPK1 domain containing adaptor with death domain - oligonucleotide/oligosaccharide-binding fold containing 2A - platelet-derived growth factor receptor, alpha polypeptide - proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) |