CRADD-CASP2 and RIPK1 domain containing adaptor with death domain Gene View larger

CRADD-CASP2 and RIPK1 domain containing adaptor with death domain Gene

PTXBC017042

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CRADD-CASP2 and RIPK1 domain containing adaptor with death domain Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CRADD-CASP2 and RIPK1 domain containing adaptor with death domain Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017042
Product type: DNA & cDNA
Ncbi symbol: CRADD
Origin species: Human
Product name: CRADD-CASP2 and RIPK1 domain containing adaptor with death domain Gene
Size: 2ug
Accessions: BC017042
Gene id: 8738
Gene description: CASP2 and RIPK1 domain containing adaptor with death domain
Synonyms: death domain containing protein CRADD; death domain-containing protein CRADD; MRT34; RAIDD; RIP-associated ICH1/CED3-homologous protein with death domain; caspase and RIP adaptor with death domain; death adaptor molecule RAIDD; CASP2 and RIPK1 domain containing adaptor with death domain
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggccagagacaaacaagtactccgctcacttcgcctggagctgggtgcagaggtattggtggagggactggttcttcagtacctctaccaggaaggaatcttgacggaaaaccatattcaagaaatcaatgctcaaaccacaggcctccggaaaacaatgctcctgctggatatcctaccttccaggggccctaaagcatttgatacattcctagattccctacaggagtttccctgggtcagggagaagctgaagaaggcaagggaagaggccatgaccgacctgcctgcaggtgacagattgactgggatcccctcgcacatcctcaacagctccccatcagaccggcagattaaccagctggcccagaggctgggccctgagtgggagcccatggtgctgtctctgggactgtcccagacggatatctaccgctgtaaggccaaccacccccacaacgtgcagtcgcaggtggtggaggccttcatccgttggcggcagcgcttcgggaagcaggccaccttccagagcctgcacaacgggctgcgggctgtggaggtggacccctcgctgctcctgcacatgttggagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - oligonucleotide/oligosaccharide-binding fold containing 2A
- platelet-derived growth factor receptor, alpha polypeptide
- proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane)
- LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase

Buy CRADD-CASP2 and RIPK1 domain containing adaptor with death domain Gene now

Add to cart