Login to display prices
Login to display prices
LFNG-LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase Gene View larger

LFNG-LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LFNG-LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LFNG-LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014851
Product type: DNA & cDNA
Ncbi symbol: LFNG
Origin species: Human
Product name: LFNG-LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase Gene
Size: 2ug
Accessions: BC014851
Gene id: 3955
Gene description: LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Synonyms: LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase; SCDO3; beta-1,3-N-acetylglucosaminyltransferase lunatic fringe
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacaccaggtcgctgctgtcttgcggctgacattcaggtagagacgttcatcttcactgacggggaagatgaggccctggccaggcacacgggcaacgtggtcatcacaaactgctcggccgcccacagccgccaggcgctgtcctgcaagatggccgtggagtatgaccgcttcatcgagtccggcaggaagtggttctgccacgtggacgatgacaactacgtcaacctgcgggccctgctgcggctgctggccagctacccgcacacgcgggacgtctacgtcggcaagcccagcctggacaggcccatccaggccatggagcgggtcagcgagaacaaggtgcgtcctgtccacttctggtttgccacgggcggcgctggcttctgcatcagccgtgggctggctctgaagatgagcccgtgggccagcgggggtcacttcatgaatacggctgagcggatccggctgcctgatgactgcaccatcggctacatcgtggaggccctgctgggtgtgcccctcatccgcagcggcctcttccactcccacctggagaacctgcagcaggtgcccacctcggagctccacgagcaggtgacgctgagctacggtatgtttgaaaacaagcggaacgccgtccacgtgaaggggcccttctcggtggaggccgacccatccaggttccgctccatccactgccacctgtacccggacacaccctggtgtccccgcactgccatcttctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - glycerophosphodiester phosphodiesterase domain containing 1
- solute carrier family 19 (thiamine transporter), member 2
- aldo-keto reductase family 1, member B1 (aldose reductase)
- aldo-keto reductase family 1, member B1 (aldose reductase)