Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
OBFC2A-oligonucleotide/oligosaccharide-binding fold containing 2A Gene
PTXBC017114
New product
Data sheet of OBFC2A-oligonucleotide/oligosaccharide-binding fold containing 2A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about OBFC2A-oligonucleotide/oligosaccharide-binding fold containing 2A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017114 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | OBFC2A |
| Origin species: | Human |
| Product name: | OBFC2A-oligonucleotide/oligosaccharide-binding fold containing 2A Gene |
| Size: | 2ug |
| Accessions: | BC017114 |
| Gene id: | 64859 |
| Gene description: | oligonucleotide/oligosaccharide-binding fold containing 2A |
| Synonyms: | OBFC2A; SOSS-B2; SSB2; SOSS complex subunit B2; oligonucleotide/oligosaccharide-binding fold containing 2A; oligonucleotide/oligosaccharide-binding fold-containing protein 2A; sensor of single-strand DNA complex subunit B2; sensor of ssDNA subunit B2; single-stranded DNA-binding protein 2; nucleic acid binding protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaatagggtcaacgacccacttatttttataagagatattaagcccggactgaaaaacttaaatgtcgtctttattgtcctggagataggacgcgtgaccaaaaccaaagacggccatgaagtgagatcgtgcaaagtagcagataaaacgggcagcatcactatttccgtgtgggatgagatcggaggtcttatacagccaggggatattattcggttgaccagagggtatgcatccatgtggaaaggatgtctgacactttatactggaaggggtggtgaacttcaaaaaattggggaattttgtatggtttattcagaagtgccaaatttcagtgaacccaacccagattatcgaggacagcagaacaaaggggcacagagtgaacagaagaataattccatgaatagtaatatgggtacaggtacatttggaccagtgggaaatggtgttcacactggccctgaatcaagggaacaccagttttcacatgctggcagaagcaatggccggggacttataaatccacaactacaaggaacagctagtaatcaaacagtgatgaccacaataagtaatggcagggaccctcggagagcctttaaaagatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - platelet-derived growth factor receptor, alpha polypeptide - proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) - LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase - glycerophosphodiester phosphodiesterase domain containing 1 |