OBFC2A-oligonucleotide/oligosaccharide-binding fold containing 2A Gene View larger

OBFC2A-oligonucleotide/oligosaccharide-binding fold containing 2A Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of OBFC2A-oligonucleotide/oligosaccharide-binding fold containing 2A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about OBFC2A-oligonucleotide/oligosaccharide-binding fold containing 2A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017114
Product type: DNA & cDNA
Ncbi symbol: OBFC2A
Origin species: Human
Product name: OBFC2A-oligonucleotide/oligosaccharide-binding fold containing 2A Gene
Size: 2ug
Accessions: BC017114
Gene id: 64859
Gene description: oligonucleotide/oligosaccharide-binding fold containing 2A
Synonyms: OBFC2A; SOSS-B2; SSB2; SOSS complex subunit B2; oligonucleotide/oligosaccharide-binding fold containing 2A; oligonucleotide/oligosaccharide-binding fold-containing protein 2A; sensor of single-strand DNA complex subunit B2; sensor of ssDNA subunit B2; single-stranded DNA-binding protein 2; nucleic acid binding protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatagggtcaacgacccacttatttttataagagatattaagcccggactgaaaaacttaaatgtcgtctttattgtcctggagataggacgcgtgaccaaaaccaaagacggccatgaagtgagatcgtgcaaagtagcagataaaacgggcagcatcactatttccgtgtgggatgagatcggaggtcttatacagccaggggatattattcggttgaccagagggtatgcatccatgtggaaaggatgtctgacactttatactggaaggggtggtgaacttcaaaaaattggggaattttgtatggtttattcagaagtgccaaatttcagtgaacccaacccagattatcgaggacagcagaacaaaggggcacagagtgaacagaagaataattccatgaatagtaatatgggtacaggtacatttggaccagtgggaaatggtgttcacactggccctgaatcaagggaacaccagttttcacatgctggcagaagcaatggccggggacttataaatccacaactacaaggaacagctagtaatcaaacagtgatgaccacaataagtaatggcagggaccctcggagagcctttaaaagatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - platelet-derived growth factor receptor, alpha polypeptide
- proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane)
- LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
- glycerophosphodiester phosphodiesterase domain containing 1

Buy OBFC2A-oligonucleotide/oligosaccharide-binding fold containing 2A Gene now

Add to cart