Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PDGFRA-platelet-derived growth factor receptor, alpha polypeptide Gene
PTXBC015186
New product
Data sheet of PDGFRA-platelet-derived growth factor receptor, alpha polypeptide Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PDGFRA-platelet-derived growth factor receptor, alpha polypeptide Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015186 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PDGFRA |
| Origin species: | Human |
| Product name: | PDGFRA-platelet-derived growth factor receptor, alpha polypeptide Gene |
| Size: | 2ug |
| Accessions: | BC015186 |
| Gene id: | 5156 |
| Gene description: | platelet-derived growth factor receptor, alpha polypeptide |
| Synonyms: | PDGFRA/BCR fusion; CD140A; GAS9; PDGFR-2; PDGFR2; RHEPDGFRA; platelet-derived growth factor receptor alpha; CD140 antigen-like family member A; CD140a antigen; PDGF-R-alpha; alpha-type platelet-derived growth factor receptor; platelet-derived growth factor receptor 2; platelet-derived growth factor receptor, alpha polypeptide; rearranged-in-hypereosinophilia-platelet derived growth factor receptor alpha fusion protein; platelet derived growth factor receptor alpha |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggacttcccatccggcgttcctggtcttaggctgtcttctcacagggctgagcctaatcctctgccagctttcattaccctctatccttccaaatgaaaatgaaaaggttgtgcagctgaattcatccttttctctgagatgctttggggagagtgaagtgagctggcagtaccccatgtctgaagaagagagctccgatgtggaaatcagaaatgaagaaaacaacagcggcctttttgtgacggtcttggaagtgagcagtgcctcggcggcccacacagggttgtacacttgctattacaaccacactcagacagaagagaatgagcttgaaggcaggcacatttacatctatgtgccagacccagatgtagcctttgtacctctaggaatgacggattatttagtcatcgtggaggatgatgattctgccattataccttgtcgcacaactgatcccgagactcctgtaaccttacacaacagtgagggggtggtacctgcctcctacgacagcagacagggctttaatgggaccttcactgtagggccctatatctgtgaggccaccgtcaaaggaaagaagttccagaccatcccatttaatgtttatgctttaaaaggtacttgtatcatctccttccttctttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) - LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase - glycerophosphodiester phosphodiesterase domain containing 1 - solute carrier family 19 (thiamine transporter), member 2 |