Login to display prices
Login to display prices
NAT13-N-acetyltransferase 13 (GCN5-related) Gene View larger

NAT13-N-acetyltransferase 13 (GCN5-related) Gene

PTXBC012731

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NAT13-N-acetyltransferase 13 (GCN5-related) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NAT13-N-acetyltransferase 13 (GCN5-related) Gene

Proteogenix catalog: PTXBC012731
Ncbi symbol: NAT13
Product name: NAT13-N-acetyltransferase 13 (GCN5-related) Gene
Size: 2ug
Accessions: BC012731
Gene id: 80218
Gene description: N-acetyltransferase 13 (GCN5-related)
Synonyms: NAT13; MAK3; NAT13P; NAT5; NAT5P; SAN; N-alpha-acetyltransferase 50; N-acetyltransferase 13 (GCN5-related); N-acetyltransferase 5; N-acetyltransferase san homolog; natE catalytic subunit; N(alpha)-acetyltransferase 50, NatE catalytic subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaaggtagccggatcgagctgggagatgtgacaccacacaatattaaacagttgaaaagattgaatcaggtcatctttccagtcagctacaatgacaagttctacaaggatgtgctggaggttggcgagctagcaaaacttgcctatttcaatgatattgctgtaggtgcagtatgctgtagggtggatcattcacagaatcagaagagactttacatcatgacactaggatgtctggcaccttaccgaaggctaggaataggaactaaaatgttaaatcatgtcttaaacatctgtgaaaaagatggtacttttgacaacatttatctgcatgtccagatcagcaatgagtcggcaattgacttctacaggaagtttggctttgagattattgagacaaagaagaactactataagaggatagagcccgcagatgctcatgtgctgcagaaaaacctcaaagttccttctggtcagaatgcagatgtgcaaaagacagacaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice