VIP-vasoactive intestinal peptide Gene View larger

VIP-vasoactive intestinal peptide Gene

PTXBC009794

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of VIP-vasoactive intestinal peptide Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about VIP-vasoactive intestinal peptide Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009794
Product type: DNA & cDNA
Ncbi symbol: VIP
Origin species: Human
Product name: VIP-vasoactive intestinal peptide Gene
Size: 2ug
Accessions: BC009794
Gene id: 7432
Gene description: vasoactive intestinal peptide
Synonyms: prepro-VIP; VIP peptides; PHM27; vasoactive intestinal peptide
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacaccagaaataaggcccagctccttgtgctcctgactcttctcagtgtgctcttctcacagacttcggcatggcctctttacagggcaccttctgctctcaggttgggtgacagaataccctttgagggagcaaatgaacctgatcaagtttcattaaaagaagacattgacatgttgcaaaatgcattagctgaaaatgacacaccctattatgatgtatccagaaatgccaggcatgctgatggagttttcaccagtgacttcagtaaactcttgggtcaactttctgccaaaaagtaccttgagtctcttatgggaaaacgtgttagtaacatctcagaagaccctgtaccagtcaaacgtcactcagatgcagtcttcactgacaactatacccgccttagaaaacaaatggctgtaaagaaatatttgaactcaattctgaatggaaagaggagcagtgagggagaatctcccgactttccagaagagttagaaaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tryptophan rich basic protein
- mediator complex subunit 30
- methyltransferase like 7B
- fibroblast growth factor 18

Buy VIP-vasoactive intestinal peptide Gene now

Add to cart