Product successfully added to your shopping cart
Quantity
Total
There are 7 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 067,59 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 067,59 €
Data sheet of VIP-vasoactive intestinal peptide Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about VIP-vasoactive intestinal peptide Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009794 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | VIP |
| Origin species: | Human |
| Product name: | VIP-vasoactive intestinal peptide Gene |
| Size: | 2ug |
| Accessions: | BC009794 |
| Gene id: | 7432 |
| Gene description: | vasoactive intestinal peptide |
| Synonyms: | prepro-VIP; VIP peptides; PHM27; vasoactive intestinal peptide |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacaccagaaataaggcccagctccttgtgctcctgactcttctcagtgtgctcttctcacagacttcggcatggcctctttacagggcaccttctgctctcaggttgggtgacagaataccctttgagggagcaaatgaacctgatcaagtttcattaaaagaagacattgacatgttgcaaaatgcattagctgaaaatgacacaccctattatgatgtatccagaaatgccaggcatgctgatggagttttcaccagtgacttcagtaaactcttgggtcaactttctgccaaaaagtaccttgagtctcttatgggaaaacgtgttagtaacatctcagaagaccctgtaccagtcaaacgtcactcagatgcagtcttcactgacaactatacccgccttagaaaacaaatggctgtaaagaaatatttgaactcaattctgaatggaaagaggagcagtgagggagaatctcccgactttccagaagagttagaaaaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tryptophan rich basic protein - mediator complex subunit 30 - methyltransferase like 7B - fibroblast growth factor 18 |