Login to display prices
Login to display prices
ADCK5-aarF domain containing kinase 5 Gene View larger

ADCK5-aarF domain containing kinase 5 Gene

PTXBC031570

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ADCK5-aarF domain containing kinase 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ADCK5-aarF domain containing kinase 5 Gene

Proteogenix catalog: PTXBC031570
Ncbi symbol: ADCK5
Product name: ADCK5-aarF domain containing kinase 5 Gene
Size: 2ug
Accessions: BC031570
Gene id: 203054
Gene description: aarF domain containing kinase 5
Synonyms: uncharacterized aarF domain-containing protein kinase 5; aarF domain containing kinase 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagggcgcacgcagccgcactgggggtgcaagactacctcctgttcgccgagatgctcatgcagcgccccgtgcgcctggggcagctgtggggctcgcacctactgagccgcgaagaggcggcctacatggtggacatggcccgcgagcgcttcgaggccgtcatggcggtgctcagggagctgccgcggcccatgctgctggtgctgcgcaacatcaacaccgtgcgcgctatcaacgtggccctcggcgcccccgtggaccgctacttccttatggctaaaagggctgtccggggctggagccgcctggcgggcgccacgtatcggggtgtctacggcaccagcctcctgcgccacgccaaggtcgtctgggagatgctcaagtttgaagtggcgctcaggctggagaccttggccatgcggctgaccgccctcctggctcgtgctctggtccacctgagcctcgtgcccccagcggaggagctctaccagtacctggagacctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice