Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of XTP3TPA-XTP3-transactivated protein A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about XTP3TPA-XTP3-transactivated protein A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001344 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | XTP3TPA |
| Origin species: | Human |
| Product name: | XTP3TPA-XTP3-transactivated protein A Gene |
| Size: | 2ug |
| Accessions: | BC001344 |
| Gene id: | 79077 |
| Gene description: | XTP3-transactivated protein A |
| Synonyms: | XTP3TPA; CDA03; RS21C6; dCTP pyrophosphatase 1; XTP3-transactivated gene A protein; XTP3-transactivated protein A; dCTPase 1; deoxycytidine-triphosphatase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctgtggccggtggggagattcgtggggacacggggggagaggacactgctgctcccggccggttcagcttcagcccggagcccacgctcgaggacatccgccgcctccatgctgagtttgctgcggaacgagactgggaacagttccatcagcctcggaatctcctcctggccttggttggggaagtgggggagctggcagaactctttcagtggaaaaccgatggggaacctggcccccaaggctggtcccccagggaacgggcagcccttcaagaggagcttagtgacgtcctcatctacctggtggcattagcagcccgctgccgtgtggatctgccgctagcagtgctctccaaaatggacatcaaccggcgacgctacccagcccatctggcccgcagctcttcccgcaagtatacagaattgccccatggggccatctctgaagaccaggctgtggggcctgcggacattccctgtgactccacaggccagacctcaacctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ADP-ribosylation factor-like 8B - ADP-ribosylation factor-like 14 - chromatin modifying protein 2B - synovial sarcoma, X breakpoint 2 |