Login to display prices
Login to display prices
XTP3TPA-XTP3-transactivated protein A Gene View larger

XTP3TPA-XTP3-transactivated protein A Gene

PTXBC001344

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of XTP3TPA-XTP3-transactivated protein A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about XTP3TPA-XTP3-transactivated protein A Gene

Proteogenix catalog: PTXBC001344
Ncbi symbol: XTP3TPA
Product name: XTP3TPA-XTP3-transactivated protein A Gene
Size: 2ug
Accessions: BC001344
Gene id: 79077
Gene description: XTP3-transactivated protein A
Synonyms: XTP3TPA; CDA03; RS21C6; dCTP pyrophosphatase 1; XTP3-transactivated gene A protein; XTP3-transactivated protein A; dCTPase 1; deoxycytidine-triphosphatase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgtggccggtggggagattcgtggggacacggggggagaggacactgctgctcccggccggttcagcttcagcccggagcccacgctcgaggacatccgccgcctccatgctgagtttgctgcggaacgagactgggaacagttccatcagcctcggaatctcctcctggccttggttggggaagtgggggagctggcagaactctttcagtggaaaaccgatggggaacctggcccccaaggctggtcccccagggaacgggcagcccttcaagaggagcttagtgacgtcctcatctacctggtggcattagcagcccgctgccgtgtggatctgccgctagcagtgctctccaaaatggacatcaaccggcgacgctacccagcccatctggcccgcagctcttcccgcaagtatacagaattgccccatggggccatctctgaagaccaggctgtggggcctgcggacattccctgtgactccacaggccagacctcaacctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice