Login to display prices
Login to display prices
XTP3TPA-XTP3-transactivated protein A Gene View larger

XTP3TPA-XTP3-transactivated protein A Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of XTP3TPA-XTP3-transactivated protein A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about XTP3TPA-XTP3-transactivated protein A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001344
Product type: DNA & cDNA
Ncbi symbol: XTP3TPA
Origin species: Human
Product name: XTP3TPA-XTP3-transactivated protein A Gene
Size: 2ug
Accessions: BC001344
Gene id: 79077
Gene description: XTP3-transactivated protein A
Synonyms: XTP3TPA; CDA03; RS21C6; dCTP pyrophosphatase 1; XTP3-transactivated gene A protein; XTP3-transactivated protein A; dCTPase 1; deoxycytidine-triphosphatase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgtggccggtggggagattcgtggggacacggggggagaggacactgctgctcccggccggttcagcttcagcccggagcccacgctcgaggacatccgccgcctccatgctgagtttgctgcggaacgagactgggaacagttccatcagcctcggaatctcctcctggccttggttggggaagtgggggagctggcagaactctttcagtggaaaaccgatggggaacctggcccccaaggctggtcccccagggaacgggcagcccttcaagaggagcttagtgacgtcctcatctacctggtggcattagcagcccgctgccgtgtggatctgccgctagcagtgctctccaaaatggacatcaaccggcgacgctacccagcccatctggcccgcagctcttcccgcaagtatacagaattgccccatggggccatctctgaagaccaggctgtggggcctgcggacattccctgtgactccacaggccagacctcaacctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ADP-ribosylation factor-like 8B
- ADP-ribosylation factor-like 14
- chromatin modifying protein 2B
- synovial sarcoma, X breakpoint 2