CHMP2B-chromatin modifying protein 2B Gene View larger

CHMP2B-chromatin modifying protein 2B Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CHMP2B-chromatin modifying protein 2B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CHMP2B-chromatin modifying protein 2B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001553
Product type: DNA & cDNA
Ncbi symbol: CHMP2B
Origin species: Human
Product name: CHMP2B-chromatin modifying protein 2B Gene
Size: 2ug
Accessions: BC001553
Gene id: 25978
Gene description: chromatin modifying protein 2B
Synonyms: ALS17; CHMP2.5; DMT1; VPS2-2; VPS2B; charged multivesicular body protein 2b; VPS2 homolog B; chromatin modifying protein 2B; vacuolar protein-sorting-associated protein 2-2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgtccctcttcaagaagaaaaccgtggatgatgtaataaaggaacagaatcgagagttacgaggtacacagagggctataatcagagatcgagcagctttagagaaacaagaaaaacagctggaattagaaattaagaaaatggccaagattggtaataaggaagcttgcaaagttttagccaaacaacttgtgcatctacggaaacagaagacgagaacttttgctgtaagttcaaaagttacttctatgtctacacaaacaaaagtgatgaattcccaaatgaagatggctggagcaatgtctaccacagcaaaaacaatgcaggcagttaacaagaagatggatccacaaaagacattacaaacaatgcagaatttccagaaggaaaacatgaaaatggaaatgactgaagaaatgatcaatgatacacttgatgacatctttgacggttctgatgacgaagaagaaagccaggatattgtgaatcaagttcttgatgaaattggaattgaaatttctggaaagatggccaaagctccatcagctgctcgaagcttaccatctgcctctacttcaaaggctacaatctcagatgaagagattgaacggcaactcaaggctttaggagtagattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - synovial sarcoma, X breakpoint 2
- zinc finger, AN1-type domain 3
- NAD(P)H dehydrogenase, quinone 2
- G protein-coupled receptor 175

Buy CHMP2B-chromatin modifying protein 2B Gene now

Add to cart