Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of GPR175-G protein-coupled receptor 175 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GPR175-G protein-coupled receptor 175 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017058 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GPR175 |
| Origin species: | Human |
| Product name: | GPR175-G protein-coupled receptor 175 Gene |
| Size: | 2ug |
| Accessions: | BC017058 |
| Gene id: | 131601 |
| Gene description: | G protein-coupled receptor 175 |
| Synonyms: | integral membrane protein GPR175; GPR175; TMEM227; TPRA40; transmembrane protein adipocyte-associated 1; G protein-coupled receptor 175; seven transmembrane domain orphan receptor; transmembrane domain protein regulated in adipocytes 40 kDa; transmembrane protein 227; transmembrane protein, adipocyte asscociated 1; transmembrane protein adipocyte associated 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacaccctggaggaggtgacttgggccaatgggagcacagcgctacccccacccctggcaccaaacatcagtgtgcctcatcgctgcctgctgctgctctacgaagacattggcacctccagggtccggtactgggacctcttgctgctcatccccaatgtgctcttcctcatcttcctgctctggaagcttccatctgctcgggcgaagatccgcatcacctccagccccatttttatcaccttctacatcctggtgtttgtggtggcgctggtgggcattgcccgggccgtggtatccatgacggtgagcacctcgaacgctgcaactgttgctgataagatcctgtgggagatcacccgcttcttcctgctggccatcgagctgagtgtgatcatcctgggcctggcctttggccacctggagagtaagtccagcatcaagcgggtgctggccatcaccacagtgctgtccctggcctactctgtcacccaggggaccctggagatcctgtaccctgatgcccatctctcagctgaggactttaatatctatggccatgggggccgccagttctggctggtcagctcctgcttcttcttcctgctcggaggagcttctacgtgtatgcgggcatcctggcactgctcaacctactgcaggggctggggagtgtgctgctgtgcttcgacatcatcgaggggctctgctgtgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protease, serine, 2 (trypsin 2) - tripartite motif-containing 74 - kallikrein-related peptidase 11 - ubiquitin specific peptidase 48 |