USP48-ubiquitin specific peptidase 48 Gene View larger

USP48-ubiquitin specific peptidase 48 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of USP48-ubiquitin specific peptidase 48 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about USP48-ubiquitin specific peptidase 48 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013567
Product type: DNA & cDNA
Ncbi symbol: USP48
Origin species: Human
Product name: USP48-ubiquitin specific peptidase 48 Gene
Size: 2ug
Accessions: BC013567
Gene id: 84196
Gene description: ubiquitin specific peptidase 48
Synonyms: RAP1GA1; USP31; ubiquitin carboxyl-terminal hydrolase 48; deubiquitinating enzyme 48; ubiquitin specific protease 31; ubiquitin thioesterase 48; ubiquitin thiolesterase 48; ubiquitin-specific-processing protease 48; ubiquitin specific peptidase 48
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtttacatttgcttccatgaccaaagaagattctaaacttatagctctcatatggcccagtgagtggcaaatgatacaaaagctctttgttgtggatcatgtaattaaaatcacgagaattgaagtgggagatgtaaacccttcagaaacacagtatatttctgagcccaaactctgtccagaatgcagagaaggcttattgtgtcagcagcagagggacctgcgtgaatacactcaagccaccatctatgtccataaagttgtggataataaaaaggtgatgaaggattcggctccggaactgaatgtgagtagttctgaaacagaggaggacaaggaagaagctaaaccagatggagaaaaagatccagattttaatcaaagcaatggtggaacaaagcggcaaaagatatcccatcaaaattatatagcctatcaaaagcaagttattcgccgaagtatgcgacatagaaaagttcgtggtgagaaagcacttctcgtttctgctaatcagacgttaaaagaattgaaaattcagatcatgcatgcattttcagttgctccttttgaccagaatttgtcaattgatggaaagattttaagtgatgactgtgccaccctaggcacccttggcgtcattcctgaatctgtcattttattgaaggctgatgaaccaattgcagattatgctgcaatggatgatgtcatgcaagtttgtatgccagaagaagggtttaaaggtactggtcttcttggacattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hydroxyacylglutathione hydrolase
- NECAP endocytosis associated 2
- testis-specific serine kinase 6
- kallikrein-related peptidase 10

Buy USP48-ubiquitin specific peptidase 48 Gene now

Add to cart