NECAP2-NECAP endocytosis associated 2 Gene View larger

NECAP2-NECAP endocytosis associated 2 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NECAP2-NECAP endocytosis associated 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NECAP2-NECAP endocytosis associated 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017014
Product type: DNA & cDNA
Ncbi symbol: NECAP2
Origin species: Human
Product name: NECAP2-NECAP endocytosis associated 2 Gene
Size: 2ug
Accessions: BC017014
Gene id: 55707
Gene description: NECAP endocytosis associated 2
Synonyms: adaptin ear-binding coat-associated protein 2; adaptin-ear-binding coat-associated protein 2; NECAP endocytosis associated 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggagagcgggtacgagtcggtgctctgtgtcaagcctgacgtccacgtctaccgcatccctccgcgggctaccaaccgtggctacagggctgcggagtggcagctggaccagccatcatggagtggccggctgaggatcactgcaaagggacagatggcctacatcaagctggaggacaggacgtcaggggagctctttgctcaggccccggtggatcagtttcctggcacagctgtggagagtgtgacggattccagcaggtacttcgtgatccgcatcgaagatggaaatgggcgacgggcgtttattggaattggcttcggggaccgaggtgatgcctttgacttcaatgttgcattgcaggaccatttcaagtgggtgaaacagcagtgtgaatttgcaaaacaagcccagaacccagaccaaggccctaaactggacctgggcttcaaggagggccagaccatcaagctcaacatcgcaaacatgaagaagaaggaaggagcagctgggaatccccgagtccggcctgccagcacaggagggctgagcctgcttccccctcccccaggggggaaaacctccaccctgatccctccccctggggagcagttggctgtggggggatccctcgtccagccagcagttgctcccagttcaggaggtgctcctgtaccctggccacagcccaatcctgccactgctgacatctggggagactttaccaaatctacaggatcaacttccagccagacccagccaggcacaggctgggtccagttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - testis-specific serine kinase 6
- kallikrein-related peptidase 10
- nucleotide binding protein-like
- cysteine conjugate-beta lyase 2

Buy NECAP2-NECAP endocytosis associated 2 Gene now

Add to cart