Login to display prices
Login to display prices
CCBL2-cysteine conjugate-beta lyase 2 Gene View larger

CCBL2-cysteine conjugate-beta lyase 2 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCBL2-cysteine conjugate-beta lyase 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CCBL2-cysteine conjugate-beta lyase 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000819
Product type: DNA & cDNA
Ncbi symbol: CCBL2
Origin species: Human
Product name: CCBL2-cysteine conjugate-beta lyase 2 Gene
Size: 2ug
Accessions: BC000819
Gene id: 56267
Gene description: cysteine conjugate-beta lyase 2
Synonyms: CCBL2; KAT3; KATIII; kynurenine--oxoglutarate transaminase 3; RP11-82K18.3; cysteine conjugate beta lyase 2; cysteine-S-conjugate beta-lyase 2; kynurenine aminotransferase III; kynurenine--glyoxylate transaminase; kynurenine--oxoglutarate transaminase III; kynurenine aminotransferase 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgagaatggctggagcaacacctgtttttattcccctgagatctaaacctgtttatggaaaaagatggtctagttctgactggacattagatcctcaagaactggaaagtaaatttaattccaaaaccaaagctattatactaaatactccacataacccacttggcaaggtgtataacagagaggaactgcaagtaattgctgacctttgcatcaaatatgacacactctgcatcagcgatgaggtttatgaatggcttgtatattctggaaataagcacttaaaaatagctacttttccaggtatgtgggagagaacaataacaataggaagtgctggaaagactttcagtgtaactggctggaagcttggctggtccattggtccaaatcatttgataaaacatttacagacagttcaacaaaacacgatttatacttgtgcaactcctttacaggaagccttggctcaagctttctggattgacatcaagcgcatggatgacccagaatgttactttaattctttgccaaaagagttagaagtaaaaagagatcggatggtacgtttacttgaaagtgttggcctaaaacccatagttcctgatggaggatacttcatcatcgctgatgtgtctttgctagatccagacctctctgatatgaagaataatgagccttatgactataagtttgtgaaatggatgactaaacataagaaactatcagccatccccgtttcagcattctgtaactcagagactaaatcacagtttgagaagtttgtgcgtttttgcttcattaaaaaagacagcacactggatgctgctgaagaaatcatcaaggcatggagtgtacagaagtcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tripartite motif-containing 52
- pseudouridylate synthase-like 1
- G protein-coupled receptor 162
- palmitoyl-protein thioesterase 1