GPR162-G protein-coupled receptor 162 Gene View larger

GPR162-G protein-coupled receptor 162 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GPR162-G protein-coupled receptor 162 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GPR162-G protein-coupled receptor 162 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002353
Product type: DNA & cDNA
Ncbi symbol: GPR162
Origin species: Human
Product name: GPR162-G protein-coupled receptor 162 Gene
Size: 2ug
Accessions: BC002353
Gene id: 27239
Gene description: G protein-coupled receptor 162
Synonyms: GRCA; gene rich cluster, A; gene-rich cluster gene A protein; G protein-coupled receptor 162
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgagcactggggtggtgagcttcttctccctcaagtcggactcggcgcccccctggatggtgctggctgtgctgtggtgctccatggcacagacgctgctgctgccctccttcatctggtcctgcgagcgctaccgcgccgacgtgcgcacagtgtgggagcaatgcgtggccatcatgtctgaggaggatggagatgacgatgggggctgtgacgactatgcagagggccgagtttgcaaagttcgctttgatgctaacggagccacaggaccagggagccgggaccccgcccaggtgaagctgctgcctggaaggcacatgctcttccctcctcttgagagagtccactacttacaggtccccctatcccggcgtctgtcccatgatgagacaaacatcttctctacccctcgggaaccaggctccttcctgcacaagtggtcatcctctgatgacatccgggtcctcccagcccagagccgggccctcgggggtcctcctgagtacctgggacaaagacacaggttggaggacgaggaggacgaggaagaggctgaaggtggggggctggccagccttcgccaattcttggagagtggggttctggggtcaggtgggggacccccacggggtcctggcttcttccgggaggagatcaccaccttcatcgatgagacacctctgccttctccgactgcctcaccagggcactctcctcgtcggccccggccactgggcctctcaccccgccgactctcccttgggtcccctgagagcagagccgttggacttcctttgggactaagcgcagggagacgctgctccctgacggggggtgaagaaagtgcaagggcttggggaggatcctggggcccaggcaaccccatctttccccagctgaccctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - palmitoyl-protein thioesterase 1
- TSC22 domain family, member 4
- NMDA receptor regulated 1-like
- melanoma antigen family A, 12

Buy GPR162-G protein-coupled receptor 162 Gene now

Add to cart