Login to display prices
Login to display prices
GPR162-G protein-coupled receptor 162 Gene View larger

GPR162-G protein-coupled receptor 162 Gene

PTXBC002353

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GPR162-G protein-coupled receptor 162 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GPR162-G protein-coupled receptor 162 Gene

Proteogenix catalog: PTXBC002353
Ncbi symbol: GPR162
Product name: GPR162-G protein-coupled receptor 162 Gene
Size: 2ug
Accessions: BC002353
Gene id: 27239
Gene description: G protein-coupled receptor 162
Synonyms: GRCA; gene rich cluster, A; gene-rich cluster gene A protein; G protein-coupled receptor 162
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgagcactggggtggtgagcttcttctccctcaagtcggactcggcgcccccctggatggtgctggctgtgctgtggtgctccatggcacagacgctgctgctgccctccttcatctggtcctgcgagcgctaccgcgccgacgtgcgcacagtgtgggagcaatgcgtggccatcatgtctgaggaggatggagatgacgatgggggctgtgacgactatgcagagggccgagtttgcaaagttcgctttgatgctaacggagccacaggaccagggagccgggaccccgcccaggtgaagctgctgcctggaaggcacatgctcttccctcctcttgagagagtccactacttacaggtccccctatcccggcgtctgtcccatgatgagacaaacatcttctctacccctcgggaaccaggctccttcctgcacaagtggtcatcctctgatgacatccgggtcctcccagcccagagccgggccctcgggggtcctcctgagtacctgggacaaagacacaggttggaggacgaggaggacgaggaagaggctgaaggtggggggctggccagccttcgccaattcttggagagtggggttctggggtcaggtgggggacccccacggggtcctggcttcttccgggaggagatcaccaccttcatcgatgagacacctctgccttctccgactgcctcaccagggcactctcctcgtcggccccggccactgggcctctcaccccgccgactctcccttgggtcccctgagagcagagccgttggacttcctttgggactaagcgcagggagacgctgctccctgacggggggtgaagaaagtgcaagggcttggggaggatcctggggcccaggcaaccccatctttccccagctgaccctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: