Cart 2 Product Products 310,50 € (empty)
-
1 x Goat...189,00 € -
1 x GPKOW-G...121,50 €
No products
To be determined Shipping
310,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 310,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 310,50 €
Data sheet of PPT1-palmitoyl-protein thioesterase 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PPT1-palmitoyl-protein thioesterase 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008426 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPT1 |
| Origin species: | Human |
| Product name: | PPT1-palmitoyl-protein thioesterase 1 Gene |
| Size: | 2ug |
| Accessions: | BC008426 |
| Gene id: | 5538 |
| Gene description: | palmitoyl-protein thioesterase 1 |
| Synonyms: | CLN1; INCL; PPT; palmitoyl-protein thioesterase 1; ceroid-palmitoyl-palmitoyl-protein thioesterase 1; palmitoyl-protein hydrolase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgtcgcccggctgcctgtggctcttggctgtggctctcctgccatggacctgcgcttctcgggcgctgcagcatctggacccgccggcgccgctgccgttggtgatctggcatgggatgggagacagctgttgcaatcccttaagcatgggtgctattaaaaaaatggtggagaagaaaatacctggaatttacgtcttatctttagagattgggaagaccctgatggaggacgtggagaacagcttcttcttgaatgtcaattcccaagtaacaacagtgtgtcaggcacttgctaaggatcctaaattgcagcaaggctacaatgctatgggattctcccagggaggccaatttctgagggcagtggctcagagatgcccttcacctcccatgatcaatctgatctcggttgggggacaacatcaaggtgtttttggactccctcgatgcccaggagagagctctcacatctgtgacttcatccgaaaaacactgaatgctggggcgtactccaaagttgttcaggaacgcctcgtgcaagccgaatactggcatgaccccataaaggaggatgtgtatcgcaaccacagcatcttcttggcagatataaatcaggagcggggtatcaatgagtcctacaagaaaaacctgatggccctgaagaagtttgtgatggtgaaattcctcaatgattccattgtggaccctgtagattcggagtggtttggattttacagaagtggccaagccaaggaaaccattcccttacaggagacctccctgtacacacaggaccgcctggggctaaaggaaatggacaatgcaggacagctagtgtttctggctacagaaggggaccatcttcagttgtctgaagaatggttttatgcccacatcataccattccttggatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - TSC22 domain family, member 4 - NMDA receptor regulated 1-like - melanoma antigen family A, 12 - death effector domain containing |