Login to display prices
Login to display prices
PPT1-palmitoyl-protein thioesterase 1 Gene View larger

PPT1-palmitoyl-protein thioesterase 1 Gene

PTXBC008426

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPT1-palmitoyl-protein thioesterase 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PPT1-palmitoyl-protein thioesterase 1 Gene

Proteogenix catalog: PTXBC008426
Ncbi symbol: PPT1
Product name: PPT1-palmitoyl-protein thioesterase 1 Gene
Size: 2ug
Accessions: BC008426
Gene id: 5538
Gene description: palmitoyl-protein thioesterase 1
Synonyms: CLN1; INCL; PPT; palmitoyl-protein thioesterase 1; ceroid-palmitoyl-palmitoyl-protein thioesterase 1; palmitoyl-protein hydrolase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgtcgcccggctgcctgtggctcttggctgtggctctcctgccatggacctgcgcttctcgggcgctgcagcatctggacccgccggcgccgctgccgttggtgatctggcatgggatgggagacagctgttgcaatcccttaagcatgggtgctattaaaaaaatggtggagaagaaaatacctggaatttacgtcttatctttagagattgggaagaccctgatggaggacgtggagaacagcttcttcttgaatgtcaattcccaagtaacaacagtgtgtcaggcacttgctaaggatcctaaattgcagcaaggctacaatgctatgggattctcccagggaggccaatttctgagggcagtggctcagagatgcccttcacctcccatgatcaatctgatctcggttgggggacaacatcaaggtgtttttggactccctcgatgcccaggagagagctctcacatctgtgacttcatccgaaaaacactgaatgctggggcgtactccaaagttgttcaggaacgcctcgtgcaagccgaatactggcatgaccccataaaggaggatgtgtatcgcaaccacagcatcttcttggcagatataaatcaggagcggggtatcaatgagtcctacaagaaaaacctgatggccctgaagaagtttgtgatggtgaaattcctcaatgattccattgtggaccctgtagattcggagtggtttggattttacagaagtggccaagccaaggaaaccattcccttacaggagacctccctgtacacacaggaccgcctggggctaaaggaaatggacaatgcaggacagctagtgtttctggctacagaaggggaccatcttcagttgtctgaagaatggttttatgcccacatcataccattccttggatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: