Login to display prices
Login to display prices
NARG1L-NMDA receptor regulated 1-like Gene View larger

NARG1L-NMDA receptor regulated 1-like Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NARG1L-NMDA receptor regulated 1-like Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NARG1L-NMDA receptor regulated 1-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032318
Product type: DNA & cDNA
Ncbi symbol: NARG1L
Origin species: Human
Product name: NARG1L-NMDA receptor regulated 1-like Gene
Size: 2ug
Accessions: BC032318
Gene id: 79612
Gene description: NMDA receptor regulated 1-like
Synonyms: NARG1L; N-alpha-acetyltransferase 16, NatA auxiliary subunit; NARG1-like protein; NMDA receptor-regulated 1-like protein; N(alpha)-acetyltransferase 16, NatA auxiliary subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgaacgtgctgctgccgcccaaggagagcaacctcttcaaacgcatcttgaaatgttatgaacagaagcagtacaaaaatggcctcaagttttgcaagatgattctgtcgaacccaaaatttgctgaacatggagagactttggctatgaaaggattaacactgaactgtttaggaaaaaaagaagaagcttatgagtttgttcgtaaaggacttcgtaatgatgtcaagagtcatgtctgttggcatgtatatggactcttgcagcgttctgataaaaaatatgatgaagctataaaatgttaccgaaatgccctcaaattagataaagataacctgcaaattttgagggatctctcactgttgcagatccaaatgagagaccttgaaggttaccgagagacaagataccagcttcttcagttgcgccccacacagcgtgcctcctggattggatatgctattgcataccatttgctgaaagattatgatatggccctaaaactgttggaagaatttagacaaactcagcaagttcctccaaacaaaatagattatgaatatagtgaattgatattataccagaatcaagtgatgagagaggcagatctgttgcaggaatctttggaacatatagaaatgtatgagaaacaaatatgtgataaacttttggtggaagaaattaaaggggaaatactgttgaaattgggaagattaaaagaagccagtgaagtgttcaaaaacttgattgatcgaaatgcagaaaactggtgttattatgaaggcttggaaaaagctctacaaattagcactttagaagagaggcttcaaatttatgaagaaattagtaagcagcaccccaaagcaattacacccagaagattacctttgactcttgtcccaggtttctataatccaggaacttgttactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - melanoma antigen family A, 12
- death effector domain containing
- TBC1 domain family, member 23
- exonuclease domain containing 1