Login to display prices
Login to display prices
EXOD1-exonuclease domain containing 1 Gene View larger

EXOD1-exonuclease domain containing 1 Gene

PTXBC010503

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EXOD1-exonuclease domain containing 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EXOD1-exonuclease domain containing 1 Gene

Proteogenix catalog: PTXBC010503
Ncbi symbol: EXOD1
Product name: EXOD1-exonuclease domain containing 1 Gene
Size: 2ug
Accessions: BC010503
Gene id: 112479
Gene description: exonuclease domain containing 1
Synonyms: EXOD1; ZGRF5; ERI1 exoribonuclease 2; enhanced RNAi three prime mRNA exonuclease homolog 2; exonuclease domain containing 1; exonuclease domain-containing protein 1; exoribonuclease 2; zinc finger, GRF-type containing 5; ERI1 exoribonuclease family member 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgaccaagcggctcgcgcggcagcttggattaattaggagaaagtcaattgcgccagcaaatggaaatctcggaagaagcaaatccaagcagttgtttgactacttaattgtcattgattttgaatcgacatgctggaatgatgggaagcaccaccatagccaggaaataattgagtttccagcagtgttgctgaacacatcaactggacagattgactctgagttccaggcttatgttcaacctcaggaacatccaattctttcagaattttgcatggaattgacaggcataaagcaggctcaagttgatgaaggagtccctctgaagatttgcttatctcagttctgtaaatggattcataagattcagcaacagaagaacattatttttgctactgggatttcagagccttctgcttctgaagtaaaattatgtgcatttgttacttggtcagactgggacttgggggtttgcctggagtatgagtgtaaaagaaaacagctgttaaaacctgtgtttttaaattcttggattgatctcagagcaacttacaagcttttctataggagaaaaccaaaaggactaagtggtgccttgcaggaagtaggaatagaattctcaggacgagaacattctgggttggacgattctcggaatactgcccttcttgcttggaaaatgatcagagatggttgtgtaatgaaaattacaaggtcgttgaacaagggtcccttcctcttgccttcgtggacctggaacagtgatctggcctcaggggaccagcatgcttttcttaagcaagaatttggctgtggaacctacagaaccttacttcagaagcccaatatgagtaaacaggaaaaggggaatattctctggttgacaatggtgtggctgtcactggcatgtctgcaaaggaaaaactacaatgactgcatgttaaacacagcatcacagactgttaccactgaaaaattttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: