EXOD1-exonuclease domain containing 1 Gene View larger

EXOD1-exonuclease domain containing 1 Gene

PTXBC010503

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EXOD1-exonuclease domain containing 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EXOD1-exonuclease domain containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010503
Product type: DNA & cDNA
Ncbi symbol: EXOD1
Origin species: Human
Product name: EXOD1-exonuclease domain containing 1 Gene
Size: 2ug
Accessions: BC010503
Gene id: 112479
Gene description: exonuclease domain containing 1
Synonyms: EXOD1; ZGRF5; ERI1 exoribonuclease 2; enhanced RNAi three prime mRNA exonuclease homolog 2; exonuclease domain containing 1; exonuclease domain-containing protein 1; exoribonuclease 2; zinc finger, GRF-type containing 5; ERI1 exoribonuclease family member 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgaccaagcggctcgcgcggcagcttggattaattaggagaaagtcaattgcgccagcaaatggaaatctcggaagaagcaaatccaagcagttgtttgactacttaattgtcattgattttgaatcgacatgctggaatgatgggaagcaccaccatagccaggaaataattgagtttccagcagtgttgctgaacacatcaactggacagattgactctgagttccaggcttatgttcaacctcaggaacatccaattctttcagaattttgcatggaattgacaggcataaagcaggctcaagttgatgaaggagtccctctgaagatttgcttatctcagttctgtaaatggattcataagattcagcaacagaagaacattatttttgctactgggatttcagagccttctgcttctgaagtaaaattatgtgcatttgttacttggtcagactgggacttgggggtttgcctggagtatgagtgtaaaagaaaacagctgttaaaacctgtgtttttaaattcttggattgatctcagagcaacttacaagcttttctataggagaaaaccaaaaggactaagtggtgccttgcaggaagtaggaatagaattctcaggacgagaacattctgggttggacgattctcggaatactgcccttcttgcttggaaaatgatcagagatggttgtgtaatgaaaattacaaggtcgttgaacaagggtcccttcctcttgccttcgtggacctggaacagtgatctggcctcaggggaccagcatgcttttcttaagcaagaatttggctgtggaacctacagaaccttacttcagaagcccaatatgagtaaacaggaaaaggggaatattctctggttgacaatggtgtggctgtcactggcatgtctgcaaaggaaaaactacaatgactgcatgttaaacacagcatcacagactgttaccactgaaaaattttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - G protein-coupled receptor 146
- melanoma antigen family D, 4B
- NMDA receptor regulated 1-like
- tripartite motif-containing 69

Buy EXOD1-exonuclease domain containing 1 Gene now

Add to cart