Login to display prices
Login to display prices
MAGED4B-melanoma antigen family D, 4B Gene View larger

MAGED4B-melanoma antigen family D, 4B Gene

PTXBC001207

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAGED4B-melanoma antigen family D, 4B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MAGED4B-melanoma antigen family D, 4B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001207
Product type: DNA & cDNA
Ncbi symbol: MAGED4B
Origin species: Human
Product name: MAGED4B-melanoma antigen family D, 4B Gene
Size: 2ug
Accessions: BC001207
Gene id: 81557
Gene description: melanoma antigen family D, 4B
Synonyms: melanoma-associated antigen D4; MAGE-D4 antigen; MAGE-E1 antigen; melanoma antigen family D, 4B; melanoma antigen family D4B; MAGE family member D4B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgattaaggactacaagaagatccccatcaagcgcgcagacatgctgaaggatgtcatcagagaatatgatgaacatttccctgagatcattgaacgagcaacgtacaccctggaaaagaagtttgggatccacctgaaggagatcgacaaggaagaacacctgtatattcttgtctgcacacgggactcctcagctcgcctccttggaaaaaccaaggacactcccaggctgagtctcctcttggtgattctgggcgtcatcttcatgaatggcaaccgtgccagcgaggctgtcctctgggaggcactacgcaagatgggactgcgccctggggtgaggcacccattcctcggcgatctgaggaagctcatcacagatgactttgtgaagcagaagaacccggagctcagagaggagacgcctctgagcatggctcccagctggtacctggaatacaagaagatccccaacagcaacccacctgagtatgaattcctctggggcctgcgagcccgccatgagaccagcaagatgagggtcctgagattcatcgcccagaatcagaaccgagacccccgggaatggaaggctcatttcttggaggctgtggatgatgctttcaagacaatggatgtggatatggccgaggaacatgccagggcccagatgagggcccagatgaatatcggggatgaagcgctgattggacggtggagctgggatgacatacaagtcgagctcctgacctgggatgaggacggagattttggcgatgcctgggccaggatcccctttgctttctgggccagataccatcagtacattctgaatagcaaccgtgccaacaggagggccacgtggagagctggcgtcagcagtggcaccaatggaggggccagcaccagcgtcctagatggccccagcaccagctccaccatccggaccagaaatgctgccagagctggcgccagcttcttctcctggatccagcaccgttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NMDA receptor regulated 1-like
- tripartite motif-containing 69
- slingshot homolog 3 (Drosophila)
- tribbles homolog 2 (Drosophila)