GPR146-G protein-coupled receptor 146 Gene View larger

GPR146-G protein-coupled receptor 146 Gene

PTXBC014241

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GPR146-G protein-coupled receptor 146 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GPR146-G protein-coupled receptor 146 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014241
Product type: DNA & cDNA
Ncbi symbol: GPR146
Origin species: Human
Product name: GPR146-G protein-coupled receptor 146 Gene
Size: 2ug
Accessions: BC014241
Gene id: 115330
Gene description: G protein-coupled receptor 146
Synonyms: PGR8; G-protein coupled receptor PGR8; G protein-coupled receptor 146
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggagctgcagctggttcaacggcacagggctggtggaggagctgcctgcctgccaggacctgcagctggggctgtcactgttgtcgctgctgggcctggtggtgggcgtgccagtgggcctgtgctacaacgccctgctggtgctggccaacctacacagcaaggccagcatgaccatgccggacgtgtactttgtcaacatggcagtggcaggcctggtgctcagcgccctggcccctgtgcacctgctcggccccccgagctcccggtgggcgctgtggagtgtgggcggcgaagtccacgtggcactgcagatccccttcaatgtgtcctcactggtggccatgtactccaccgccctgctgagcctcgaccactacatcgagcgtgcactgccgcggacctacatggccagcgtgtacaacacgcggcacgtgtgcggcttcgtgtggggtggcgcgctgctgaccagcttctcctcgctgctcttctacatctgcagccatgtgtccacccgcgcgctagagtgcgccaagatgcagaacgcagaagctgccgacgccacgctggtgttcatcggctacgtggtgccagcactggccaccctctacgcgctggtgctactctcccgcgtccgcagggaggacacgcccctggaccgggacacgggccggctggagccctcggcacacaggctgctggtggccaccgtgtgcacgcagtttgggctctggacgccacactatctgatcctgctggggcacacggtcatcatctcgcgagggaagcccgtggacgcacactacctggggctactgcactttgtgaaggatttctccaaactcctggccttctccagcagctttgtgacaccacttctctaccgctacatgaaccagagcttccccagcaagctccaacggctgatgaaaaagctgccctgcggggaccggcactgctccccggaccacatgggggtgcagcaggtgctggcgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - melanoma antigen family D, 4B
- NMDA receptor regulated 1-like
- tripartite motif-containing 69
- slingshot homolog 3 (Drosophila)

Buy GPR146-G protein-coupled receptor 146 Gene now

Add to cart