MAGEA12-melanoma antigen family A, 12 Gene View larger

MAGEA12-melanoma antigen family A, 12 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAGEA12-melanoma antigen family A, 12 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MAGEA12-melanoma antigen family A, 12 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003408
Product type: DNA & cDNA
Ncbi symbol: MAGEA12
Origin species: Human
Product name: MAGEA12-melanoma antigen family A, 12 Gene
Size: 2ug
Accessions: BC003408
Gene id: 4111
Gene description: melanoma antigen family A, 12
Synonyms: CT1.12; MAGE12; melanoma-associated antigen 12; MAGE12F antigen; cancer/testis antigen 1.12; cancer/testis antigen family 1, member 12; melanoma antigen family A, 12; melanoma antigen family A12; MAGE family member A12
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccacttgagcagaggagtcagcactgcaagcctgaggaaggccttgaggcccaaggagaggccctgggcttggtgggtgcgcaggctcctgctactgaggagcaggagactgcctcctcctcctctactctagtggaagtcaccctgcgggaggtgcctgctgccgagtcaccaagtcctccccacagtcctcagggagcctccaccctccccactaccatcaactatactctctggagtcaatccgatgagggctccagcaacgaagaacaggaagggccaagcacctttcctgacctggagacgagcttccaagtagcactcagtaggaagatggctgagttggttcattttctgctcctcaagtatcgagccagggagccattcacaaaggcagaaatgctggggagtgtcatcagaaatttccaggacttctttcctgtgatcttcagcaaagcctccgagtacttgcagctggtctttggcatcgaggtggtggaagtggtccgcatcggccacttgtacatccttgtcacctgcctgggcctctcctacgatggcctgctgggcgacaatcagatcgtgcccaagacaggcctcctgataatcgtcctggccataatcgcaaaagagggcgactgtgcccctgaggagaaaatctgggaggagctgagtgtgttggaggcatctgatgggagggaggacagtgtctttgcgcatcccaggaagctgctcacccaagatttggtgcaggaaaactacctggagtaccggcaggtccccggcagtgatcctgcatgctacgagttcctgtggggtccaagggccctcgttgaaaccagctatgtgaaagtcctgcaccatttgctaaagatcagtggaggacctcacatttcctacccacccctgcatgaatgggcttttagagagggggaagagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - death effector domain containing
- TBC1 domain family, member 23
- exonuclease domain containing 1
- G protein-coupled receptor 146

Buy MAGEA12-melanoma antigen family A, 12 Gene now

Add to cart