Cart 17 Product Products 1 901,29 € (empty)
-
1 x UTP3-UTP3,...121,50 € -
-
-
-
1 x RNF11-ring...113,40 € -
-
-
-
1 x HAT1-histo...113,40 € -
1 x CCDC108-co...113,40 € -
1 x Goat...119,00 € -
1 x ASNA1-arsA...121,50 € -
1 x CLK4-CDC-l...113,40 € -
-
-
1 x Sheep...199,00 € -
1 x KOMBITEST™...201,40 €
No products
To be determined Shipping
1 901,29 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 17 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 901,29 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 901,29 €
Data sheet of MAGEA12-melanoma antigen family A, 12 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MAGEA12-melanoma antigen family A, 12 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003408 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MAGEA12 |
| Origin species: | Human |
| Product name: | MAGEA12-melanoma antigen family A, 12 Gene |
| Size: | 2ug |
| Accessions: | BC003408 |
| Gene id: | 4111 |
| Gene description: | melanoma antigen family A, 12 |
| Synonyms: | CT1.12; MAGE12; melanoma-associated antigen 12; MAGE12F antigen; cancer/testis antigen 1.12; cancer/testis antigen family 1, member 12; melanoma antigen family A, 12; melanoma antigen family A12; MAGE family member A12 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccacttgagcagaggagtcagcactgcaagcctgaggaaggccttgaggcccaaggagaggccctgggcttggtgggtgcgcaggctcctgctactgaggagcaggagactgcctcctcctcctctactctagtggaagtcaccctgcgggaggtgcctgctgccgagtcaccaagtcctccccacagtcctcagggagcctccaccctccccactaccatcaactatactctctggagtcaatccgatgagggctccagcaacgaagaacaggaagggccaagcacctttcctgacctggagacgagcttccaagtagcactcagtaggaagatggctgagttggttcattttctgctcctcaagtatcgagccagggagccattcacaaaggcagaaatgctggggagtgtcatcagaaatttccaggacttctttcctgtgatcttcagcaaagcctccgagtacttgcagctggtctttggcatcgaggtggtggaagtggtccgcatcggccacttgtacatccttgtcacctgcctgggcctctcctacgatggcctgctgggcgacaatcagatcgtgcccaagacaggcctcctgataatcgtcctggccataatcgcaaaagagggcgactgtgcccctgaggagaaaatctgggaggagctgagtgtgttggaggcatctgatgggagggaggacagtgtctttgcgcatcccaggaagctgctcacccaagatttggtgcaggaaaactacctggagtaccggcaggtccccggcagtgatcctgcatgctacgagttcctgtggggtccaagggccctcgttgaaaccagctatgtgaaagtcctgcaccatttgctaaagatcagtggaggacctcacatttcctacccacccctgcatgaatgggcttttagagagggggaagagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - death effector domain containing - TBC1 domain family, member 23 - exonuclease domain containing 1 - G protein-coupled receptor 146 |