PUSL1-pseudouridylate synthase-like 1 Gene View larger

PUSL1-pseudouridylate synthase-like 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PUSL1-pseudouridylate synthase-like 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PUSL1-pseudouridylate synthase-like 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034304
Product type: DNA & cDNA
Ncbi symbol: PUSL1
Origin species: Human
Product name: PUSL1-pseudouridylate synthase-like 1 Gene
Size: 2ug
Accessions: BC034304
Gene id: 126789
Gene description: pseudouridylate synthase-like 1
Synonyms: tRNA pseudouridine synthase-like 1; tRNA pseudouridylate synthase-like 1; tRNA-uridine isomerase-like 1; pseudouridylate synthase-like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagttcggcgccggcctcaggctccgtgcgcgcgcgctatcttgtgtacttccagtacgtgggcaccgactttaacggggtcgcggccgtcaggggcactcagcgcgccgtcggggtccagaactacctggaggaggccgccgagcggctgaattccgtggagccggtcaggttcaccatctccagccgcacggacgccggggtccacgccctgagcaacgcggcgcacctggacgtccagcgccgctcaggccggccgcccttcccgcccgaggtcctggccgaggccctcaacacacacctgcggcacccggccatcagggtcctgcgggccttccgagtgcccagcgacttccacgctcgtcacgcagccacgtcccggacctacctgtaccgcctggccactggctgtcaccggcgtgatgagctgccggtgtttgaacgcaacctatgctggactctcccggcagactgcctggatatggtcgccatgcaggaagccgcccagcacctcctcggcacacacgacttcagcgccttccagtccgctggcagcccggtgccgagccccgtgcgaacgctgcgccgggtctccgtttccccaggccaagccagccccttggtcacccccgaggagagcaggaagctgcggttctggaacctggagtttgagagccagtctttcctgtatagacaggtacggaggatgacggctgtgctggtggccgtggggctgggggctttggcacctgcccaggtgaagacgattctggagagccaagatcccctgggcaagcaccagacacgtgtagccccagcccacggcttattcctcaagtcagtgctgtacgggaacctcggtgctgcctcctgcaccctgcaggggccacagttcgggagccacggatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - G protein-coupled receptor 162
- palmitoyl-protein thioesterase 1
- TSC22 domain family, member 4
- NMDA receptor regulated 1-like

Buy PUSL1-pseudouridylate synthase-like 1 Gene now

Add to cart