Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of KLK10-kallikrein-related peptidase 10 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KLK10-kallikrein-related peptidase 10 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002710 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KLK10 |
| Origin species: | Human |
| Product name: | KLK10-kallikrein-related peptidase 10 Gene |
| Size: | 2ug |
| Accessions: | BC002710 |
| Gene id: | 5655 |
| Gene description: | kallikrein-related peptidase 10 |
| Synonyms: | NES1; PRSSL1; kallikrein-10; breast normal epithelial cell associated serine protease; kallikrein 10 protein 1; kallikrein 10 protein 12; kallikrein 10 protein 13; kallikrein 10 protein 2; kallikrein 10 protein 3; kallikrein 10 protein 4; kallikrein 10 protein 5; kallikrein 10 protein 7; kallikrein 10 protein 8; kallikrein 10 protein 9; normal epithelial cell-specific 1; protease serine-like 1; kallikrein related peptidase 10 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagagctccgcacctccacctctccgccgcctctggcgcccgggctctggcgaagctgctgccgctgctgatggcgcaactctgggccgcagaggcggcgctgctcccccaaaacgacacgcgcttggaccccgaagcctatggcgccccgtgcgcgcgcggctcgcagccctggcaggtctcgctcttcaacggcctctcgttccactgcgcgggtgtcctggtggaccagagttgggtgctgacggccgcgcactgcggaaacaagccactgtgggctcgagtaggggatgaccacctgctgcttcttcagggcgagcagctccgccggacgactcgctctgttgtccatcccaagtaccaccagggctcaggccccatcctgccaaggcgaacggatgagcacgatctcatgttgctaaagctggccaggcccgtagtgccggggccccgcgtccgggccctgcagcttccctaccgctgtgctcagcccggagaccagtgccaggttgctggctggggcaccacggccgcccggagagtgaagtacaacaagggcctgacctgctccagcatcactatcctgagccctaaagagtgtgaggtcttctaccctggcgtggtcaccaacaacatgatatgtgctggactggaccggggccaggacccttgccagagtgactctggaggccccctggtctgtgacgagaccctccaaggcatcctctcgtggggtgtttacccctgtggctctgcccagcatccagctgtctacacccagatctgcaaatacatgtcctggatcaataaagtcatacgctccaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nucleotide binding protein-like - cysteine conjugate-beta lyase 2 - tripartite motif-containing 52 - pseudouridylate synthase-like 1 |