HAGH-hydroxyacylglutathione hydrolase Gene View larger

HAGH-hydroxyacylglutathione hydrolase Gene

PTXBC000840

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HAGH-hydroxyacylglutathione hydrolase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HAGH-hydroxyacylglutathione hydrolase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000840
Product type: DNA & cDNA
Ncbi symbol: HAGH
Origin species: Human
Product name: HAGH-hydroxyacylglutathione hydrolase Gene
Size: 2ug
Accessions: BC000840
Gene id: 3029
Gene description: hydroxyacylglutathione hydrolase
Synonyms: GLO2; GLX2; GLXII; HAGH1; hydroxyacylglutathione hydrolase, mitochondrial; glx II; glyoxalase II; hydroxyacylglutathione hydroxylase; hydroxyacylglutathione hydrolase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaggtagaggtgctgcctgccctgaccgacaactacatgtacctggtcattgatgatgagaccaaggaggctgccattgtggatccggtgcagccccagaaggtcgtggacgcggcgagaaagcacggggtgaaactgaccacagtgctcaccacccaccaccactgggaccatgctggcgggaatgagaaactggtcaagctggagtcgggactgaaggtgtacgggggtgacgaccgtatcggggccctgactcacaagatcactcacctgtctacactgcaggtggggtctctgaacgtcaagtgcctggcgaccccgtgccacacttcaggacacatttgttacttcgtgagcaagcccggaggctcggagccccctgccgtgttcacaggtgacaccttgtttgtggctggctgcgggaagttctatgaagggactgcggatgagatgtgtaaagctctgctggaggtcttgggccggctccccccggacacaagagtctactgtggccacgagtacaccatcaacaacctcaagtttgcacgccacgtggagcccggcaatgccgccatccgggagaagctggcctgggccaaggagaagtacagcatcggggagcccacagtgccatccaccctggcagaggagtttacctacaaccccttcatgagagtgagggagaagacggtgcagcagcacgcaggtgagacggacccggtgaccaccatgcgggccgtgcgcagggagaaggaccagttcaagatgccccgggactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NECAP endocytosis associated 2
- testis-specific serine kinase 6
- kallikrein-related peptidase 10
- nucleotide binding protein-like

Buy HAGH-hydroxyacylglutathione hydrolase Gene now

Add to cart