Login to display prices
Login to display prices
ARL14-ADP-ribosylation factor-like 14 Gene View larger

ARL14-ADP-ribosylation factor-like 14 Gene

PTXBC034354

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ARL14-ADP-ribosylation factor-like 14 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ARL14-ADP-ribosylation factor-like 14 Gene

Proteogenix catalog: PTXBC034354
Ncbi symbol: ARL14
Product name: ARL14-ADP-ribosylation factor-like 14 Gene
Size: 2ug
Accessions: BC034354
Gene id: 80117
Gene description: ADP-ribosylation factor-like 14
Synonyms: ARF7; ADP-ribosylation factor-like protein 14; ADP-ribosylation factor 7; ADP-ribosylation factor-like 14; ADP ribosylation factor like GTPase 14
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggttcgctgggttctaaaaatccgcaaaccaaacaagcccaagttcttcttttgggacttgactcagctgggaagtctactctcctttataaattaaagcttgctaaggatattaccaccatccctacaataggtttcaatgtggaaatgatcgagttggaaaggaatttttcactcacagtctgggatgttggaggacaggaaaaaatgagaactgtttggggctgttactgtgagaacaccgatgggctggtgtatgttgtggacagtacagacaaacagcgactggaagagtctcagagacagtttgagcacattttgaagaatgaacacattaaaaatgtgcctgttgttctattagccaacaaacaagacatgcctggagctctgactgctgaggacatcaccagaatgttcaaagtgaagaagctttgcagtgaccggaactggtatgtgcaaccctgctgtgccctcacaggggaggggctggcccaggggttcaggaaattaactggatttgtgaagagccacatgaaatcaagaggagacactttggcgttcttcaagcagaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice