Login to display prices
Login to display prices
ARL8B-ADP-ribosylation factor-like 8B Gene View larger

ARL8B-ADP-ribosylation factor-like 8B Gene

PTXBC013131

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ARL8B-ADP-ribosylation factor-like 8B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ARL8B-ADP-ribosylation factor-like 8B Gene

Proteogenix catalog: PTXBC013131
Ncbi symbol: ARL8B
Product name: ARL8B-ADP-ribosylation factor-like 8B Gene
Size: 2ug
Accessions: BC013131
Gene id: 55207
Gene description: ADP-ribosylation factor-like 8B
Synonyms: ARL10C; Gie1; ADP-ribosylation factor-like protein 8B; ADP-ribosylation factor-like 10C; ADP-ribosylation factor-like 8B; ADP-ribosylation factor-like protein 10C; novel small G protein indispensable for equal chromosome segregation 1; ADP ribosylation factor like GTPase 8B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctggcgctcatctcccgcctgctggactggttccgttcgctcttctggaaggaagagatggagctgacgctcgtggggctgcagtactcgggcaagaccaccttcgtcaatgtcatcgcgtcaggtcaattcagtgaagatatgatacccacagtgggcttcaacatgaggaaggtaactaaaggtaacgtcacaataaagatctgggacataggaggacaaccccgatttcgaagcatgtgggagcggtattgcagaggagtcaatgctattgtttacatgatagatgctgcagatcgtgaaaagatagaagcttcccgaaatgagctacataatcttctagataaaccacagttacaaggaattccagtgctagtgcttggaaacaagagagatcttcctaatgccttggatgagaaacagctaattgaaaaaatgaatctgtctgctattcaggatagagaaatttgctgctattcaatttcttgcaaagaaaaggataatatagatatcacacttcagtggcttattcagcattcaaaatctagaagaagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice