Login to display prices
Login to display prices
THYN1-thymocyte nuclear protein 1 Gene View larger

THYN1-thymocyte nuclear protein 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of THYN1-thymocyte nuclear protein 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about THYN1-thymocyte nuclear protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006978
Product type: DNA & cDNA
Ncbi symbol: THYN1
Origin species: Human
Product name: THYN1-thymocyte nuclear protein 1 Gene
Size: 2ug
Accessions: BC006978
Gene id: 29087
Gene description: thymocyte nuclear protein 1
Synonyms: HSPC144; MDS012; MY105; THY28; THY28KD; thymocyte nuclear protein 1; thymocyte protein thy28
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgagaccccggaagaggctggctgggacttctggttcagacaagggactatcaggaaaacgcaccaaaactgagaactcaggtgaggcattagctaaagtggaggactccaaccctcagaagacttcagccactaaaaactgtttgaagaatctaagcagccactggctgatgaagtcagagccagagagccgcctagagaaaggtgtagatgtgaagttcagcattgaggatctcaaagcacagcccaaacagacaacatgctgggatggtgttcgtaactaccaggctcggaacttccttagagccatgaagctgggagaagaagccttcttctaccatagcaactgcaaagagccaggcatcgcaggactcatgaagatcgtgaaagaggcttacccagaccacacacagtttgagaaaaacaatccccattatgacccatctagcaaagaggacaaccctaagtggtccatgaagagtttgattttgttttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - vasoactive intestinal peptide
- tryptophan rich basic protein
- mediator complex subunit 30
- methyltransferase like 7B