Cart 10 Product Products 1 839,95 € (empty)
-
-
1 x FITC-Linke...180,32 € -
-
-
-
1 x C16orf70-c...121,50 € -
1 x ZSCAN20-zi...121,50 € -
-
1 x F2R-coagul...121,50 € -
No products
To be determined Shipping
1 839,95 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 10 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 839,95 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 839,95 €
Data sheet of THYN1-thymocyte nuclear protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about THYN1-thymocyte nuclear protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006978 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | THYN1 |
| Origin species: | Human |
| Product name: | THYN1-thymocyte nuclear protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC006978 |
| Gene id: | 29087 |
| Gene description: | thymocyte nuclear protein 1 |
| Synonyms: | HSPC144; MDS012; MY105; THY28; THY28KD; thymocyte nuclear protein 1; thymocyte protein thy28 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgagaccccggaagaggctggctgggacttctggttcagacaagggactatcaggaaaacgcaccaaaactgagaactcaggtgaggcattagctaaagtggaggactccaaccctcagaagacttcagccactaaaaactgtttgaagaatctaagcagccactggctgatgaagtcagagccagagagccgcctagagaaaggtgtagatgtgaagttcagcattgaggatctcaaagcacagcccaaacagacaacatgctgggatggtgttcgtaactaccaggctcggaacttccttagagccatgaagctgggagaagaagccttcttctaccatagcaactgcaaagagccaggcatcgcaggactcatgaagatcgtgaaagaggcttacccagaccacacacagtttgagaaaaacaatccccattatgacccatctagcaaagaggacaaccctaagtggtccatgaagagtttgattttgttttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - vasoactive intestinal peptide - tryptophan rich basic protein - mediator complex subunit 30 - methyltransferase like 7B |