Login to display prices
Login to display prices
STK32A-serine/threonine kinase 32A Gene View larger

STK32A-serine/threonine kinase 32A Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of STK32A-serine/threonine kinase 32A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about STK32A-serine/threonine kinase 32A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021666
Product type: DNA & cDNA
Ncbi symbol: STK32A
Origin species: Human
Product name: STK32A-serine/threonine kinase 32A Gene
Size: 2ug
Accessions: BC021666
Gene id: 202374
Gene description: serine/threonine kinase 32A
Synonyms: YANK1; serine/threonine-protein kinase 32A; A930015B13Rik; CTB-108O6.2; yet another novel kinase 1; serine/threonine kinase 32A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggagccaacacttcaagaaaaccaccagtgtttgatgaaaatgaagatgtcaactttgaccactttgaaattttgcgagccattgggaaaggcagttttgggaaggtctgcattgtacagaagaatgataccaagaagatgtacgcaatgaagtacatgaataaacaaaagtgcgtggagcgcaatgaagtgagaaatgtcttcaaggaactccagatcatgcagggtctggagcaccctttcctggttaatttgtggtattccttccaagatgaggaagacatgttcatggtggtggacctcctgctgggtggagacctgcgttatcacctgcaacagaacgtccacttcaaggaagaaacagtgaagctcttcatctgtgagctggtcatggccctggactacctgcagaaccagcgcatcattcacagggatatgaagcctgacaatattttacttgacgaacatgatacctggctctcctacaagtcccactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RNA binding motif protein 8A
- ferritin, heavy polypeptide 1
- sperm associated antigen 16
- PERP, TP53 apoptosis effector