Login to display prices
Login to display prices
ACAT1-acetyl-Coenzyme A acetyltransferase 1 Gene View larger

ACAT1-acetyl-Coenzyme A acetyltransferase 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ACAT1-acetyl-Coenzyme A acetyltransferase 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ACAT1-acetyl-Coenzyme A acetyltransferase 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010942
Product type: DNA & cDNA
Ncbi symbol: ACAT1
Origin species: Human
Product name: ACAT1-acetyl-Coenzyme A acetyltransferase 1 Gene
Size: 2ug
Accessions: BC010942
Gene id: 38
Gene description: acetyl-Coenzyme A acetyltransferase 1
Synonyms: ACAT; MAT; THIL; acetyl-CoA acetyltransferase, mitochondrial; acetoacetyl Coenzyme A thiolase; acetoacetyl-CoA thiolase; acetyl-Coenzyme A acetyltransferase 1; mitochondrial acetoacetyl-CoA thiolase; testicular tissue protein Li 198; acetyl-CoA acetyltransferase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgtgctgccggcacttctgcgcagcggcgcccgcagccgcagccccctgctccggaggctggtgcaggaaataagatatgtggaacggagttatgtatcaaaacccactttgaaggaagtggtcatagtaagtgctacaagaacacccattggatcttttttaggcagcctttccttgctgccagccactaagcttggttccattgcaattcagggagccattgaaaaggcagggattccaaaagaagaagtgaaagaagcatacatgggtaatgttctacaaggaggtgaaggacaagctcctacaaggcaggcagtattgggtgcaggcttacctatttctactccatgtaccaccataaacaaagtttgtgcttcaggaatgaaagccatcatgatggcctctcaaagtcttatgtgtggacatcagatcaagcaagagacaggctccttagcaaaaatatgctgtcatgtcaggaggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - N-acetyltransferase 13 (GCN5-related)
- intermediate filament family orphan 1
- GINS complex subunit 3 (Psf3 homolog)
- GrpE-like 1, mitochondrial (E. coli)