Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 395,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 395,00 €
Data sheet of TNNC2-troponin C type 2 (fast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TNNC2-troponin C type 2 (fast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005323 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TNNC2 |
| Origin species: | Human |
| Product name: | TNNC2-troponin C type 2 (fast) Gene |
| Size: | 2ug |
| Accessions: | BC005323 |
| Gene id: | 7125 |
| Gene description: | troponin C type 2 (fast) |
| Synonyms: | troponin C, skeletal muscle; troponin C type 2 (fast); troponin C2, fast; troponin C2, fast skeletal type |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacggaccagcaggctgaggccaggtcctacctcagcgaagagatgatcgctgagttcaaggctgcctttgacatgtttgatgctgatggtggtggggacatcagcgtcaaggagttgggcacggtgatgaggatgctgggccagacacccaccaaggaggagctggacgccatcatcgaggaggtggatgaggacggcagcggcaccatcgacttcgaggagttcttggtcatgatggtgcgccagatgaaagaggacgcgaaagggaagagcgaggaggagctggccgagtgcttccgcatcttcgacaggaatgcagacggctacatcgacccggaggagctggctgagattttcagggcctccggggagcacgtgactgacgaggagatcgaatctctgatgaaagacggcgacaagaacaacgacggccgcattgacttcgacgagttcctgaagatgatggagggcgtgcagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - BCL2-related protein A1 - ADP-ribosylation factor 4 - ring finger protein 208 - zinc finger protein 655 |