TNNC2-troponin C type 2 (fast) Gene View larger

TNNC2-troponin C type 2 (fast) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TNNC2-troponin C type 2 (fast) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TNNC2-troponin C type 2 (fast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005323
Product type: DNA & cDNA
Ncbi symbol: TNNC2
Origin species: Human
Product name: TNNC2-troponin C type 2 (fast) Gene
Size: 2ug
Accessions: BC005323
Gene id: 7125
Gene description: troponin C type 2 (fast)
Synonyms: troponin C, skeletal muscle; troponin C type 2 (fast); troponin C2, fast; troponin C2, fast skeletal type
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacggaccagcaggctgaggccaggtcctacctcagcgaagagatgatcgctgagttcaaggctgcctttgacatgtttgatgctgatggtggtggggacatcagcgtcaaggagttgggcacggtgatgaggatgctgggccagacacccaccaaggaggagctggacgccatcatcgaggaggtggatgaggacggcagcggcaccatcgacttcgaggagttcttggtcatgatggtgcgccagatgaaagaggacgcgaaagggaagagcgaggaggagctggccgagtgcttccgcatcttcgacaggaatgcagacggctacatcgacccggaggagctggctgagattttcagggcctccggggagcacgtgactgacgaggagatcgaatctctgatgaaagacggcgacaagaacaacgacggccgcattgacttcgacgagttcctgaagatgatggagggcgtgcagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - BCL2-related protein A1
- ADP-ribosylation factor 4
- ring finger protein 208
- zinc finger protein 655

Buy TNNC2-troponin C type 2 (fast) Gene now

Add to cart