Login to display prices
Login to display prices
MPHOSPH6-M-phase phosphoprotein 6 Gene View larger

MPHOSPH6-M-phase phosphoprotein 6 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MPHOSPH6-M-phase phosphoprotein 6 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MPHOSPH6-M-phase phosphoprotein 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005242
Product type: DNA & cDNA
Ncbi symbol: MPHOSPH6
Origin species: Human
Product name: MPHOSPH6-M-phase phosphoprotein 6 Gene
Size: 2ug
Accessions: BC005242
Gene id: 10200
Gene description: M-phase phosphoprotein 6
Synonyms: MPP; MPP-6; MPP6; M-phase phosphoprotein 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggccgagagaaagacaaagttgtccaagaatctgctgcgcatgaagtttatgcaaaggggactggactcagaaaccaagaaacaactagaagaagaagaaaagaaaatcattagtgaagagcactggtacttggatttgccagagcttaaagagaaagagagtttcataatagaagagcagagtttcttactatgtgaagatcttctctatggaagaatgtcattcagaggatttaatcctgaggttgagaaattgatgcttcagatgaatgctaagcacaaagcagaagaagttgaagatgaaacagtagagcttgatgtgtcagatgaagagatggctagaagatatgagaccttggtggggacaattgggaaaaagtttgccagaaagagagaccatgccaattatgaagaagatgaaaatggagacataacaccaattaaagcaaagaagatgttcttaaagccccaggattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - thymocyte nuclear protein 1
- vasoactive intestinal peptide
- tryptophan rich basic protein
- mediator complex subunit 30