Login to display prices
Login to display prices
PMP22-peripheral myelin protein 22 Gene View larger

PMP22-peripheral myelin protein 22 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PMP22-peripheral myelin protein 22 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PMP22-peripheral myelin protein 22 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC019040
Product type: DNA & cDNA
Ncbi symbol: PMP22
Origin species: Human
Product name: PMP22-peripheral myelin protein 22 Gene
Size: 2ug
Accessions: BC019040
Gene id: 5376
Gene description: peripheral myelin protein 22
Synonyms: CMT1A; CMT1E; DSS; GAS-3; GAS3; HMSNIA; HNPP; Sp110; peripheral myelin protein 22; growth arrest-specific protein 3; peripheral myelin protein 22 kDa
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctcctcctgttgctgagtatcatcgtcctccacgtcgcggtgctggtgctgctgttcgtctccacgatcgtcagccaatggatcgtgggcaatggacacgcaactgatctctggcagaactgtagcacctcttcctcaggaaatgtccaccactgtttctcatcatcaccaaacgaatggctgcagtctgtccaggccaccatgatcctgtcgatcatcttcagcattctgtctctgttcctgttcttctgccaactcttcaccctcaccaaggggggcaggttttacatcactggaatcttccaaattcttgctggtctgtgcgtgatgagtgctgcggccatctacacggtgaggcacccggagtggcatctcaactcggattactcctacggtttcgcctacatcctggcctgggtggccttccccctggcccttctcagcggtgtcatctatgtgatcttgcggaaacgcgaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - serine/threonine kinase 32A
- RNA binding motif protein 8A
- ferritin, heavy polypeptide 1
- sperm associated antigen 16