Login to display prices
Login to display prices
SCAMP1-secretory carrier membrane protein 1 Gene View larger

SCAMP1-secretory carrier membrane protein 1 Gene

PTXBC009787

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SCAMP1-secretory carrier membrane protein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SCAMP1-secretory carrier membrane protein 1 Gene

Proteogenix catalog: PTXBC009787
Ncbi symbol: SCAMP1
Product name: SCAMP1-secretory carrier membrane protein 1 Gene
Size: 2ug
Accessions: BC009787
Gene id: 9522
Gene description: secretory carrier membrane protein 1
Synonyms: SCAMP; SCAMP37; secretory carrier-associated membrane protein 1; secretory carrier membrane protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcggatttcgacagtaacccgtttgccgacccggatctcaacaatcccttcaaggatccatcagttacacaagtgacaagaaatgttccaccaggacttgatgaatataatccattctcggattctagaacacctccaccaggcggtgtgaagatgcctaatgtacccaatacacaaccagcaataatgaaaccaacagaggaacatccagcttatacacagattgcaaaggaacatgcattggcccaagctgaacttcttaagcgccaggaagaactagaaagaaaagccgcagaattagatcgtcgggaacgagaaatgcaaaacctcagtcaacatggtagaaaaaataattggccacctcttcctagcaattttcctgtcggaccttgtttctatcaggatttttctgtagacattcctgtagaattccaaaagacagtaaagcttatgtactacttgtggatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice