ZNF607-zinc finger protein 607 Gene View larger

ZNF607-zinc finger protein 607 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF607-zinc finger protein 607 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF607-zinc finger protein 607 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005085
Product type: DNA & cDNA
Ncbi symbol: ZNF607
Origin species: Human
Product name: ZNF607-zinc finger protein 607 Gene
Size: 2ug
Accessions: BC005085
Gene id: 84775
Gene description: zinc finger protein 607
Synonyms: zinc finger protein 607
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgccaaagtgtttgagtccatcggcaagtttggcctggccttagctgttgcaggaggcatggtgacctctgccttatgtaatgtggatgctgggcacagagctgccatctttgaccaattccgtggagtacagaacattgtggtaggggaagggactcactttctcatcccatgtgtacaaaaaccaattatctttgactgctgttctcaaccacgtagtgcgccagtcatcactggtagcaaagatttacagaatgtcaacatcacactgtgcatcctcttccggcccatcactagccagcttcctcgcatcttcaccagcattggagaggactacgatgagtgtgtgctgccgttcattaccacggagatcctcaagtcactggtggctcgctttgatgctggagaactaatcacccagagggagctggtctccagccaggtgagcaacaaccttatggagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - troponin C type 2 (fast)
- BCL2-related protein A1
- ADP-ribosylation factor 4
- ring finger protein 208

Buy ZNF607-zinc finger protein 607 Gene now

Add to cart