CAPN3-calpain 3, (p94) Gene View larger

CAPN3-calpain 3, (p94) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CAPN3-calpain 3, (p94) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CAPN3-calpain 3, (p94) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003521
Product type: DNA & cDNA
Ncbi symbol: CAPN3
Origin species: Human
Product name: CAPN3-calpain 3, (p94) Gene
Size: 2ug
Accessions: BC003521
Gene id: 825
Gene description: calpain 3, (p94)
Synonyms: CANP3; CANPL3; LGMD2; LGMD2A; nCL-1; p94; calpain-3; calpain p94, large [catalytic] subunit; calpain, large polypeptide L3; muscle-specific calcium-activated neutral protease 3 large subunit; new calpain 1; calpain 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagatctgtgcagatgagctcaagaaggtccttaacacagtcgtgaacaaacacaaggacctgaagacacacgggttcacactggagtcctgccgtagcatgattgcgctcatggatacagatggctctggaaagctcaacctgcaggagttccaccacctctggaacaagattaaggcctggcagaaaattttcaaacactatgacacagaccagtccggcaccatcaacagctacgagatgcgaaatgcagtcaacgacgcaggattccacctcaacaaccagctctatgacatcattaccatgcggtacgcagacaaacacatgaacatcgactttgacagtttcatctgctgcttcgttaggctggagggcatgttcagagcttttcatgcatttgacaaggatggagatggtatcatcaagctcaacgttctggagtggctgcagctcaccatgtatgcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - sorting nexin 12
- lysozyme G-like 1
- MARCKS-like 1
- docking protein 5

Buy CAPN3-calpain 3, (p94) Gene now

Add to cart