CUTA-cutA divalent cation tolerance homolog (E. coli) Gene View larger

CUTA-cutA divalent cation tolerance homolog (E. coli) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CUTA-cutA divalent cation tolerance homolog (E. coli) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CUTA-cutA divalent cation tolerance homolog (E. coli) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005890
Product type: DNA & cDNA
Ncbi symbol: CUTA
Origin species: Human
Product name: CUTA-cutA divalent cation tolerance homolog (E. coli) Gene
Size: 2ug
Accessions: BC005890
Gene id: 51596
Gene description: cutA divalent cation tolerance homolog (E. coli)
Synonyms: cutA divalent cation tolerance homolog; divalent cation tolerant protein CUTA; protein CutA; ACHAP; C6orf82; acetylcholinesterase-associated protein; brain acetylcholinesterase putative membrane anchor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccggcgctgctgcctgtggcctcccgccttttgttgctaccccgagtcttgctgaccatggcctctggaagccctccgacccagccctcgccggcctcggattccggctctggctacgttccgggctcggtctctgcagcctttgttacttgccccaacgagaaggtcgccaaggagatcgccagggccgtggtggagaagcgcctagcagcctgcgtcaacctcatccctcagattacatccatctatgagtggaaagggaagatcgaggaagacagtgaggtgctgatgatgattaaaacccaaagttccttggtcccagctttgacagattttgttcgttctgtgcacccttacgaagtggccgaggtaattgcattgcctgtggaacaggggaactttccgtacctgcagtgggtgcgccaggtcacagagtcagtttctgactctatcacagtcctgccatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - vitamin K epoxide reductase complex, subunit 1
- family with sequence similarity 176, member B
- family with sequence similarity 156, member A
- NFS1 nitrogen fixation 1 homolog (S. cerevisiae)

Buy CUTA-cutA divalent cation tolerance homolog (E. coli) Gene now

Add to cart