NFS1-NFS1 nitrogen fixation 1 homolog (S. cerevisiae) Gene View larger

NFS1-NFS1 nitrogen fixation 1 homolog (S. cerevisiae) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NFS1-NFS1 nitrogen fixation 1 homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NFS1-NFS1 nitrogen fixation 1 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018471
Product type: DNA & cDNA
Ncbi symbol: NFS1
Origin species: Human
Product name: NFS1-NFS1 nitrogen fixation 1 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC018471
Gene id: 9054
Gene description: NFS1 nitrogen fixation 1 homolog (S. cerevisiae)
Synonyms: NFS1, cysteine desulfurase; NFS1 nitrogen fixation 1 homolog; HUSSY-08; IscS; NIFS; cysteine desulfurase, mitochondrial; nitrogen fixation 1 (S. cerevisiae, homolog); nitrogen-fixing bacteria S-like protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgctccgagccgcttggaggcgggcggcagtggcggtgacagcggctccagggccgaagcccgcggcgcccactcgggggctgcgcctgcgcgttggagaccgtgctcctcagtctgcggttcccgcagatacagccgctgccccggaggtggggccagtgctgcgacctctctatatggatgtgcaagctacaactcctctggacccccgggtgcttgatgccatgctcccttacctaatcaactactatgggaacccacactcccggacacatgcttatggctgggagagtgaggcagccatggaacgtgctcgtcagcaagtagcatctctgattggagctgatcctcgtgagatcatttttactagtggtgctactgaatccaacaacatagcaattaagactgagtctcactctgtcatccaggctggagtgcagtggcacgatcttgactcactgcaagctccgcctcctgggttcacgccattctcctgcctcagcctcctgagtagctgggactacaggcgccctccaccacacccggctaattttttgtatttttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 71, member E2
- v-crk sarcoma virus CT10 oncogene homolog (avian)
- poly (ADP-ribose) polymerase family, member 11
- Notch homolog 2 (Drosophila) N-terminal like

Buy NFS1-NFS1 nitrogen fixation 1 homolog (S. cerevisiae) Gene now

Add to cart