Login to display prices
Login to display prices
NFS1-NFS1 nitrogen fixation 1 homolog (S. cerevisiae) Gene View larger

NFS1-NFS1 nitrogen fixation 1 homolog (S. cerevisiae) Gene

PTXBC018471

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NFS1-NFS1 nitrogen fixation 1 homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NFS1-NFS1 nitrogen fixation 1 homolog (S. cerevisiae) Gene

Proteogenix catalog: PTXBC018471
Ncbi symbol: NFS1
Product name: NFS1-NFS1 nitrogen fixation 1 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC018471
Gene id: 9054
Gene description: NFS1 nitrogen fixation 1 homolog (S. cerevisiae)
Synonyms: NFS1, cysteine desulfurase; NFS1 nitrogen fixation 1 homolog; HUSSY-08; IscS; NIFS; cysteine desulfurase, mitochondrial; nitrogen fixation 1 (S. cerevisiae, homolog); nitrogen-fixing bacteria S-like protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgctccgagccgcttggaggcgggcggcagtggcggtgacagcggctccagggccgaagcccgcggcgcccactcgggggctgcgcctgcgcgttggagaccgtgctcctcagtctgcggttcccgcagatacagccgctgccccggaggtggggccagtgctgcgacctctctatatggatgtgcaagctacaactcctctggacccccgggtgcttgatgccatgctcccttacctaatcaactactatgggaacccacactcccggacacatgcttatggctgggagagtgaggcagccatggaacgtgctcgtcagcaagtagcatctctgattggagctgatcctcgtgagatcatttttactagtggtgctactgaatccaacaacatagcaattaagactgagtctcactctgtcatccaggctggagtgcagtggcacgatcttgactcactgcaagctccgcctcctgggttcacgccattctcctgcctcagcctcctgagtagctgggactacaggcgccctccaccacacccggctaattttttgtatttttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice