Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of CRK-v-crk sarcoma virus CT10 oncogene homolog (avian) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CRK-v-crk sarcoma virus CT10 oncogene homolog (avian) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009837 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CRK |
| Origin species: | Human |
| Product name: | CRK-v-crk sarcoma virus CT10 oncogene homolog (avian) Gene |
| Size: | 2ug |
| Accessions: | BC009837 |
| Gene id: | 1398 |
| Gene description: | v-crk sarcoma virus CT10 oncogene homolog (avian) |
| Synonyms: | CRK proto-oncogene, adaptor protein; v-crk sarcoma virus CT10 oncogene-like protein; v-crk avian sarcoma virus CT10 oncogene homolog; proto-oncogene c-Crk; adapter molecule crk; CRKII; p38 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgggcaacttcgactcggaggagcggagtagctggtactgggggaggttgagtcggcaggaggcggtggcgctgctgcagggccagcggcacggggtgttcctggtgcgggactcgagcaccagccccggggactatgtgctcagcgtctcagagaactcgcgcgtctcccactacatcatcaacagcagcggcccgcgcccgccggtgccaccgtcgcccgcccagcctccgcccggggtgagcccctccagactccgaataggagatcaagagtttgattcattgcctgctttactggaattctacaaaatacactatttggacactacaacgttgatagaaccagtttccagatccaggcagggtagtggagtgattctcaggcaggaggaggcggagtatgtgcgagccctctttgactttaatgggaatgatgaggaagatcttccctttaagaaaggagacatcttgagaatccgggacaagcctgaagagcagtggtggaatgcggaggacagcgaaggcaagagagggatgattccagtcccttacgtcgagaagtatagacctgcctccgcctcagtatcggctctgattggaggtcggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - poly (ADP-ribose) polymerase family, member 11 - Notch homolog 2 (Drosophila) N-terminal like - protein phosphatase 1M (PP2C domain containing) - Williams-Beuren syndrome chromosome region 28 |