PPM1M-protein phosphatase 1M (PP2C domain containing) Gene View larger

PPM1M-protein phosphatase 1M (PP2C domain containing) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPM1M-protein phosphatase 1M (PP2C domain containing) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PPM1M-protein phosphatase 1M (PP2C domain containing) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009644
Product type: DNA & cDNA
Ncbi symbol: PPM1M
Origin species: Human
Product name: PPM1M-protein phosphatase 1M (PP2C domain containing) Gene
Size: 2ug
Accessions: BC009644
Gene id: 132160
Gene description: protein phosphatase 1M (PP2C domain containing)
Synonyms: PP2C-eta; PP2CE; PP2Ceta; protein phosphatase 1M; protein phosphatase 1M (PP2C domain containing); protein phosphatase 2C eta-2; protein phosphatase 2C isoform eta; protein phosphatase, Mg2+/Mn2+ dependent 1M
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcggctgcacagccctggtggctgtgtccctgcagggaaagctgtacatggccaatgctggggatagcagggccatcttggtgcggagagatgagatacggccactgagcttcgagttcaccccagagactgagcggcagcggatccagcagctggcctttgtctatcctgagcttctggctggtgagttcacccgactggagttccctcggcggctgaagggggatgacttgggacagaaggttttgttcagggatcaccacatgagtggctggagctacaaacgtgtggagaaatcggatctcaagtacccactgatccatggacagggtaggcaggctcggttactaggaacactggctgtctcccggggcctgggagaccatcagctcagagtcctggacacaaacatccagctcaagcccttcttgctctctgtgccacaggtgactgtgctggatgtggaccagctggagctacaggaggatgatgtggttgtcatggcaactgatggactctgggatgtactgtccaacgagcaggtggcatggctggtgcggagcttcctccctgggaaccaagaggacccacacaggttctcaaagctggcccagatgctgatacacagcacacagggaaaggaagacagtctcacagaggaagggcaggtgtcctacgatgacgtctctgtgttcgtgattcccttgcacagtcagggccaagagagcagtgaccactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Williams-Beuren syndrome chromosome region 28
- family with sequence similarity 92, member A1
- dehydrogenase/reductase (SDR family) member 12
- family with sequence similarity 164, member C

Buy PPM1M-protein phosphatase 1M (PP2C domain containing) Gene now

Add to cart