Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of PPM1M-protein phosphatase 1M (PP2C domain containing) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PPM1M-protein phosphatase 1M (PP2C domain containing) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009644 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPM1M |
| Origin species: | Human |
| Product name: | PPM1M-protein phosphatase 1M (PP2C domain containing) Gene |
| Size: | 2ug |
| Accessions: | BC009644 |
| Gene id: | 132160 |
| Gene description: | protein phosphatase 1M (PP2C domain containing) |
| Synonyms: | PP2C-eta; PP2CE; PP2Ceta; protein phosphatase 1M; protein phosphatase 1M (PP2C domain containing); protein phosphatase 2C eta-2; protein phosphatase 2C isoform eta; protein phosphatase, Mg2+/Mn2+ dependent 1M |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcggctgcacagccctggtggctgtgtccctgcagggaaagctgtacatggccaatgctggggatagcagggccatcttggtgcggagagatgagatacggccactgagcttcgagttcaccccagagactgagcggcagcggatccagcagctggcctttgtctatcctgagcttctggctggtgagttcacccgactggagttccctcggcggctgaagggggatgacttgggacagaaggttttgttcagggatcaccacatgagtggctggagctacaaacgtgtggagaaatcggatctcaagtacccactgatccatggacagggtaggcaggctcggttactaggaacactggctgtctcccggggcctgggagaccatcagctcagagtcctggacacaaacatccagctcaagcccttcttgctctctgtgccacaggtgactgtgctggatgtggaccagctggagctacaggaggatgatgtggttgtcatggcaactgatggactctgggatgtactgtccaacgagcaggtggcatggctggtgcggagcttcctccctgggaaccaagaggacccacacaggttctcaaagctggcccagatgctgatacacagcacacagggaaaggaagacagtctcacagaggaagggcaggtgtcctacgatgacgtctctgtgttcgtgattcccttgcacagtcagggccaagagagcagtgaccactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Williams-Beuren syndrome chromosome region 28 - family with sequence similarity 92, member A1 - dehydrogenase/reductase (SDR family) member 12 - family with sequence similarity 164, member C |