FAM164C-family with sequence similarity 164, member C Gene View larger

FAM164C-family with sequence similarity 164, member C Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM164C-family with sequence similarity 164, member C Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FAM164C-family with sequence similarity 164, member C Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004259
Product type: DNA & cDNA
Ncbi symbol: FAM164C
Origin species: Human
Product name: FAM164C-family with sequence similarity 164, member C Gene
Size: 2ug
Accessions: BC004259
Gene id: 79696
Gene description: family with sequence similarity 164, member C
Synonyms: protein FAM164C; FAM164C; C14orf140; zinc finger C2HC domain-containing protein 1C; family with sequence similarity 164, member C; zinc finger C2HC-type containing 1C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctggtctccagcggttggcgtcacatctgcctgtgggcgttatgctcccacataatacaacggaagctccagggccccactcagccaagcaagactcttacgaacaaggtgactcttcccagcagtccttgaaggggcacctgaggaacaatttccagaagcagcttttgagcaacaaagagttgattctggataaagtctatactcaccccaaatggaacacccaaacaaaagcccggagctactcctatccccactgtactggaatcagccagcaagatccagaaagtgattcccagggccaaggaaatggtttgttttactcgtcaggccctcaatcctggtatcccaaagccaataaccaggactttatcccctttacaaagaaacgagttggagtggaccgggcgttcccattgaaacccatggtccacaggaagtcgtgcagtacaggtgaggctggcactgatggggaccataatgtctacccaaggccccctgagccgagagagttttcatctaggaactttggtgtgaggaaccagggcaacttttctgtggttggtactgttcttgctgccacgcaggcggagaaggccgtggcaaactttgacaggacggagtgggtgcagatccgaagactagaagctgcaggggagagcttagaggaggaaatccgaagaaagcagattctcctgaggggaaagctgaagaagacagaggaggaactcagaaggatccagacgcaaaaggaacaggccaaggaaaatgaaaacggagagctacagaaaattatactccccaggagcagagttaaaggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 18, member B2
- CD40 molecule, TNF receptor superfamily member 5
- caspase 3, apoptosis-related cysteine peptidase
- family with sequence similarity 113, member B

Buy FAM164C-family with sequence similarity 164, member C Gene now

Add to cart