Login to display prices
Login to display prices
CD40-CD40 molecule, TNF receptor superfamily member 5 Gene View larger

CD40-CD40 molecule, TNF receptor superfamily member 5 Gene

PTXBC012419

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CD40-CD40 molecule, TNF receptor superfamily member 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CD40-CD40 molecule, TNF receptor superfamily member 5 Gene

Proteogenix catalog: PTXBC012419
Ncbi symbol: CD40
Product name: CD40-CD40 molecule, TNF receptor superfamily member 5 Gene
Size: 2ug
Accessions: BC012419
Gene id: 958
Gene description: CD40 molecule, TNF receptor superfamily member 5
Synonyms: CD40 molecule; CD40 molecule, TNF receptor superfamily member 5; B cell surface antigen CD40; Bp50; CDW40; TNFRSF5; p50; tumor necrosis factor receptor superfamily member 5; B cell-associated molecule; CD40L receptor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggttcgtctgcctctgcagtgcgtcctctggggctgcttgctgaccgctgtccatccagaaccacccactgcatgcagagaaaaacagtacctaataaacagtcagtgctgttctttgtgccagccaggacagaaactggtgagtgactgcacagagttcactgaaacggaatgccttccttgcggtgaaagcgaattcctagacacctggaacagagagacacactgccaccagcacaaatactgcgaccccaacctagggcttcgggtccagcagaagggcacctcagaaacagacaccatctgcacctgtgaagaaggctggcactgtacgagtgaggcctgtgagagctgtgtcctgcaccgctcatgctcgcccggctttggggtcaagcagattgctacaggggtttctgataccatctgcgagccctgcccagtcggcttcttctccaatgtgtcatctgctttcgaaaaatgtcacccttggacaagctgtgagaccaaagacctggttgtgcaacaggcaggcacaaacaagactgatgttgtctgtggtccccaggatcggctgagagccctggtggtgatccccatcatcttcgggatcctgtttgccatcctcttggtgctggtctttatcaaaaaggtggccaagaagccaaccaataaggccccccaccccaagcaggaaccccaggagatcaattttcccgacgatcttcctggctccaacactgctgctccagtgcaggagactttacatggatgccaaccggtcacccaggaggatggcaaagagagtcgcatctcagtgcaggagagacagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: