FAM131C-family with sequence similarity 131, member C Gene View larger

FAM131C-family with sequence similarity 131, member C Gene

PTXBC016848

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM131C-family with sequence similarity 131, member C Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM131C-family with sequence similarity 131, member C Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016848
Product type: DNA & cDNA
Ncbi symbol: FAM131C
Origin species: Human
Product name: FAM131C-family with sequence similarity 131, member C Gene
Size: 2ug
Accessions: BC016848
Gene id: 348487
Gene description: family with sequence similarity 131, member C
Synonyms: protein FAM131C; C1orf117; family with sequence similarity 131 member C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggctcctgcgtgtcgcgagacctgttcacaagtgcccacaagaactgccccatgccccagggtgcggaccccttgaacccagatctgccctcgggccgcactcccaccgtggctccagactgtgtcattggcaaggacgaacagatggatttctgttgggatccttggcagaggtgcttccagaccaccaacggctacctgtccgactccaggtcccgccccggcaactacaacgtggcagccctggccacctcgtcccttgtgggggtggtgcagagcatcaaggaccacatcacaaagcccacggccatggcccgaggccgcgtggcccacctcatcgagtggaagggctggagtgcccagcgggcaggctgggagctgtccccagctgaggatgagcattactgctgcctcccggatgagctgcgtgaggcccgctttgctgcaggggtcgccgagcagtttgccatcacagaggccacactgagcgcttggtcctcgctggacgaagaggagctgcaccccgagaacagcccccagggcatcgtccagctccaagatctggagagcatctaccttcaggacagccttcccagtggcccctcacaggatgacagccttcaggccttctcctcgcccagcccctcccctgacagctgtccctcacctgaggagccccccagcaccgctggcatcccgcagccccccagcccagagctgcagcatcggcggcggctgcccggggcccaaggacccgagggtgggacccaccccccgggctccctcccctccatggacagcggctccctctgggaggaggacgaggtgttctataactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 131, member A
- family with sequence similarity 181, member A
- caspase 6, apoptosis-related cysteine peptidase
- family with sequence similarity 105, member B

Buy FAM131C-family with sequence similarity 131, member C Gene now

Add to cart