PTXBC016848
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix | 
| Product type | DNA & cDNA | 
| Origin species | Human | 
| Brand: | ProteoGenix | 
| Proteogenix catalog: | PTXBC016848 | 
| Product type: | DNA & cDNA | 
| Ncbi symbol: | FAM131C | 
| Origin species: | Human | 
| Product name: | FAM131C-family with sequence similarity 131, member C Gene | 
| Size: | 2ug | 
| Accessions: | BC016848 | 
| Gene id: | 348487 | 
| Gene description: | family with sequence similarity 131, member C | 
| Synonyms: | protein FAM131C; C1orf117; family with sequence similarity 131 member C | 
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG | 
| Orf sequence: | atgggctcctgcgtgtcgcgagacctgttcacaagtgcccacaagaactgccccatgccccagggtgcggaccccttgaacccagatctgccctcgggccgcactcccaccgtggctccagactgtgtcattggcaaggacgaacagatggatttctgttgggatccttggcagaggtgcttccagaccaccaacggctacctgtccgactccaggtcccgccccggcaactacaacgtggcagccctggccacctcgtcccttgtgggggtggtgcagagcatcaaggaccacatcacaaagcccacggccatggcccgaggccgcgtggcccacctcatcgagtggaagggctggagtgcccagcgggcaggctgggagctgtccccagctgaggatgagcattactgctgcctcccggatgagctgcgtgaggcccgctttgctgcaggggtcgccgagcagtttgccatcacagaggccacactgagcgcttggtcctcgctggacgaagaggagctgcaccccgagaacagcccccagggcatcgtccagctccaagatctggagagcatctaccttcaggacagccttcccagtggcccctcacaggatgacagccttcaggccttctcctcgcccagcccctcccctgacagctgtccctcacctgaggagccccccagcaccgctggcatcccgcagccccccagcccagagctgcagcatcggcggcggctgcccggggcccaaggacccgagggtgggacccaccccccgggctccctcccctccatggacagcggctccctctgggaggaggacgaggtgttctataactga | 
| Vector: | pDONR223 | 
| Delivery lead time in business days in europe: | 10-12 days | 
| Storage: | -20â | 
| Delivery condition: | Blue Ice | 
| Related products: | - family with sequence similarity 131, member A - family with sequence similarity 181, member A - caspase 6, apoptosis-related cysteine peptidase - family with sequence similarity 105, member B |