PTXBC016848
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016848 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FAM131C |
| Origin species: | Human |
| Product name: | FAM131C-family with sequence similarity 131, member C Gene |
| Size: | 2ug |
| Accessions: | BC016848 |
| Gene id: | 348487 |
| Gene description: | family with sequence similarity 131, member C |
| Synonyms: | protein FAM131C; C1orf117; family with sequence similarity 131 member C |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggctcctgcgtgtcgcgagacctgttcacaagtgcccacaagaactgccccatgccccagggtgcggaccccttgaacccagatctgccctcgggccgcactcccaccgtggctccagactgtgtcattggcaaggacgaacagatggatttctgttgggatccttggcagaggtgcttccagaccaccaacggctacctgtccgactccaggtcccgccccggcaactacaacgtggcagccctggccacctcgtcccttgtgggggtggtgcagagcatcaaggaccacatcacaaagcccacggccatggcccgaggccgcgtggcccacctcatcgagtggaagggctggagtgcccagcgggcaggctgggagctgtccccagctgaggatgagcattactgctgcctcccggatgagctgcgtgaggcccgctttgctgcaggggtcgccgagcagtttgccatcacagaggccacactgagcgcttggtcctcgctggacgaagaggagctgcaccccgagaacagcccccagggcatcgtccagctccaagatctggagagcatctaccttcaggacagccttcccagtggcccctcacaggatgacagccttcaggccttctcctcgcccagcccctcccctgacagctgtccctcacctgaggagccccccagcaccgctggcatcccgcagccccccagcccagagctgcagcatcggcggcggctgcccggggcccaaggacccgagggtgggacccaccccccgggctccctcccctccatggacagcggctccctctgggaggaggacgaggtgttctataactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 131, member A - family with sequence similarity 181, member A - caspase 6, apoptosis-related cysteine peptidase - family with sequence similarity 105, member B |