FAM181A-family with sequence similarity 181, member A Gene View larger

FAM181A-family with sequence similarity 181, member A Gene

PTXBC009073

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM181A-family with sequence similarity 181, member A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM181A-family with sequence similarity 181, member A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009073
Product type: DNA & cDNA
Ncbi symbol: FAM181A
Origin species: Human
Product name: FAM181A-family with sequence similarity 181, member A Gene
Size: 2ug
Accessions: BC009073
Gene id: 90050
Gene description: family with sequence similarity 181, member A
Synonyms: protein FAM181A; C14orf152; family with sequence similarity 181 member A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcatccgacagtgatgtgaagatgctgctgaacttcgtgaacctggcgtccagcgacatcaaggcagccctggataagtccgcaccctgccgccgctccgtggaccatcgcaagtacctgcagaagcagctcaagcgcttctcccagaagtattcccggctcccgcggggccttcctggcagagctgctgagccctacctgaaaagggggtctgaggaccggcccaggaggctgctcctggatttgggccctgattccagccccggcgggggtgggggctgcaaggagaaggtgctgaggaacccctacagggaggaatgtcttgctaaggagcagctcccacagaggcagcatccagaagctgcccagcctggccaggtgcccatgaggaaaagacagctgcccgcttccttctgggaagagccaaggcccacccacagctaccatgtggggctggaggggggactgggccccagggagggacctccctatgagggtaagaaaaattgcaagggcttggagcccctgggacctgagactaccctggtgtccatgtctccaagggccctggctgaaaaggagccgctcaagatgcctggggtctccttggtgggccgcgtcaatgcctggagttgctgccccttccagtaccatggacagcccatctatccgggccccctgggggcactgcctcagagtcctgtccccagcctgggcctttggaggaagagcccagcctttcccggggagctggcgcacctctgcaaggatgtggacggcctggggcagaaggtgtgcaggcccgtggtgctgaaacccatccccaccaagccagccgtgcccccacccatcttcaatgtctttggctacctctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - caspase 6, apoptosis-related cysteine peptidase
- family with sequence similarity 105, member B
- heterogeneous nuclear ribonucleoprotein D-like
- enoyl Coenzyme A hydratase domain containing 1

Buy FAM181A-family with sequence similarity 181, member A Gene now

Add to cart