Login to display prices
Login to display prices
ECHDC1-enoyl Coenzyme A hydratase domain containing 1 Gene View larger

ECHDC1-enoyl Coenzyme A hydratase domain containing 1 Gene

PTXBC003549

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ECHDC1-enoyl Coenzyme A hydratase domain containing 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ECHDC1-enoyl Coenzyme A hydratase domain containing 1 Gene

Proteogenix catalog: PTXBC003549
Ncbi symbol: ECHDC1
Product name: ECHDC1-enoyl Coenzyme A hydratase domain containing 1 Gene
Size: 2ug
Accessions: BC003549
Gene id: 55862
Gene description: enoyl Coenzyme A hydratase domain containing 1
Synonyms: HEL-S-76; MMCD; dJ351K20.2; ethylmalonyl-CoA decarboxylase; enoyl CoA hydratase domain containing 1; enoyl Coenzyme A hydratase domain containing 1; enoyl-CoA hydratase domain-containing protein 1; epididymis secretory protein Li 76; methylmalonyl-CoA decarboxylase; ethylmalonyl-CoA decarboxylase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgaaaagtcttttgaagacagcctctctgtctggaaggacaaaattgctacatcaaacaggattgtcactttatagtacatcccatggattttatgaggaagaagtgaaaaaaacacttcagcagtttcctggtggatccattgaccttcagaaggaagacaatggcattggcattcttactctgaacaatccaagtagaatgaatgccttttcaggtgttatgatgctacaacttctggaaaaagtaattgaattggaaaattggacagaggggaaaggcctcattgtccgtggggcaaaaaatactttctcttcaggatctgatctgaatgctgtgaaatcactaggaactccagaggatggaatggccgtatgcatgttcatgcaaaacaccttaacaagatttatgagacttcctttaataagtgttgcgctggttcaaggttgggcattgggtggaggagcagaatttactacagcatgtgatttcaggttaatgactccagagagtaagatcagattcgtccacaaagagatgggcataataccaagctggggtggcaccacccggctagttgaaataatcggaagtagacaagctctcaaagtgttgagtggggcccttaaactggattcaaaaaatgctctaaacataggaatggttgaagaggtcttgcagtcttcagatgaaactaaatctctagaagaggcacaagaatggctaaagcaattcatccaagggccaccggaagtaattagagctttgaaaaaatctgtttgttcaggcagagagctatatttggaggaagcattacagaacgaaagagatcttttaggaacagtttggggtgggcctgcaaatttagaggctattgctaagaaaggaaaatttaataaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: