FAM175B-family with sequence similarity 175, member B Gene View larger

FAM175B-family with sequence similarity 175, member B Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM175B-family with sequence similarity 175, member B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FAM175B-family with sequence similarity 175, member B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008999
Product type: DNA & cDNA
Ncbi symbol: FAM175B
Origin species: Human
Product name: FAM175B-family with sequence similarity 175, member B Gene
Size: 2ug
Accessions: BC008999
Gene id: 23172
Gene description: family with sequence similarity 175, member B
Synonyms: AA589499; AI853413; Abro1; C430003P19Rik; BRISC complex subunit Abro1; abraxas brother protein 1; family with sequence similarity 175, member B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcctacagagagcaggttcttcacaagcagctcacccgcatcctcggcgtgcccgacctcgtctttcttctcttcagcttcatctccactgccaacaattccactcacgctttagaatatgtgctcttcagaccaaatagaaggtataatcagaggatatcactcgctattcccaatctaggaaatactagccagcaagagtacaaagtgtcttcagtgccaaatacttctcagagttatgccaaagtgattaaagaacatggtactgacttttttgacaaggatggagtgatgaaagacatcagggcgatttatcaggtttataatgcacttcaggagaaagttcaggcagtgtgtgcagatgttgaaaagagtgagcgagttgttgaatcttgtcaggcagaagtgaacaaattaagaagacaaatcactcagaggaaaaatgaaaaggaacaagaaagaagattgcagcaggcagtgttaagcagacagatgccgtctgaaagcttggacccagcgttcagtcctcggatgccgtcctctgggtttgcagctgaaggcagaagtacacttggagatgcagaggcctcggatcctcctcccccttactctgattttcacccaaacaatcaagaaagtactttgagccactctcgcatggaaaggagtgtctttatgcctcgacctcaagctgtgggctcttccaattatgcttccaccagtgccggactgaagtatcctggaagtggggctgaccttcctcctccccaaagagcagctggagacagtggtgaggattcagacgacagtgattatgaaaatttgattgaccctacagagccttctaatagtgaatactcacattcaaaggattctcgacccatggcacatcccgacgaggaccccaggaacactcagacctcccagatttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 113, member A
- BCL2/adenovirus E1B 19kDa interacting protein 2
- corticotropin releasing hormone binding protein
- family with sequence similarity 164, member A

Buy FAM175B-family with sequence similarity 175, member B Gene now

Add to cart