FAM113A-family with sequence similarity 113, member A Gene View larger

FAM113A-family with sequence similarity 113, member A Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM113A-family with sequence similarity 113, member A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FAM113A-family with sequence similarity 113, member A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014247
Product type: DNA & cDNA
Ncbi symbol: FAM113A
Origin species: Human
Product name: FAM113A-family with sequence similarity 113, member A Gene
Size: 2ug
Accessions: BC014247
Gene id: 64773
Gene description: family with sequence similarity 113, member A
Synonyms: FAM113A; C20orf81; bA12M19.1; PC-esterase domain-containing protein 1A; family with sequence similarity 113, member A; sarcoma antigen NY-SAR-23; PC-esterase domain containing 1A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtcttctgtctgtcgagcgaggagccgcgccgcccgctgcgaagcgacatggtccacttccaggcctcggaagtccagcagctgctacacaacaagttcgtggtcatcttgggggactccattcagagggctgtgtacaaggacctggtgctcttgctccagaaagactcactgctcacagctgcccagctgaaagccaagtaccttgaggatgttctggaagagctgacatatggacctgccccggacctggtgatcatcaactcctgcctctgggatctctccagatatggtcgctgctcaatggagagctaccgggagaacctggagcgggtgtttgtgcgcatggaccaagtattgccagactcctgcctgctggtgtggaacatggcgatgcccctcggggaacgtatcactgggggtttcctcctgccagagctccagcccctggcaggctccctgcggcgggatgtggttgaagggaacttctacagtgctacgctggccggggaccactgctttgatgtcctagacctccactttcacttccggcatgcagtacagcaccgtcatcgggatggtgtccactgggaccagcatgtacaccgccacctctcacacctgcttctgacccatgaattcttcaactataatccagtggaggacttctcgatgccaccccacttaggatgtggccctggagtgaactttgtgcctggccctctgccacctccaatccctggccctaatccccatggtcagcactggggcccagtggtccaccgggggatgccacgctatgttcctaacagcccctaccatgtgcggagaatgggggggccctgcaggcagcggctcagacactcagagagactgatccacacatacaaactggacagacggcctcctgcccattcggggacatggcctgggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - BCL2/adenovirus E1B 19kDa interacting protein 2
- corticotropin releasing hormone binding protein
- family with sequence similarity 164, member A
- dehydrogenase/reductase (SDR family) member 7B

Buy FAM113A-family with sequence similarity 113, member A Gene now

Add to cart