DHRS7B-dehydrogenase/reductase (SDR family) member 7B Gene View larger

DHRS7B-dehydrogenase/reductase (SDR family) member 7B Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DHRS7B-dehydrogenase/reductase (SDR family) member 7B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DHRS7B-dehydrogenase/reductase (SDR family) member 7B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004126
Product type: DNA & cDNA
Ncbi symbol: DHRS7B
Origin species: Human
Product name: DHRS7B-dehydrogenase/reductase (SDR family) member 7B Gene
Size: 2ug
Accessions: BC004126
Gene id: 25979
Gene description: dehydrogenase/reductase (SDR family) member 7B
Synonyms: CGI-93; SDR32C1; dehydrogenase/reductase SDR family member 7B; dehydrogenase/reductase (SDR family) member 7B; short-chain dehydrogenase/reductase family 32C member 1; dehydrogenase/reductase 7B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtctctccggctaccaggaagagtctgccgaaggtgaaggccatggacttcatcacctccacagccatcctgcccctgctgttcggctgcctgggcgtcttcggcctcttccggctgctgcagtgggtgcgcgggaaggcctacctgcggaatgctgtggtggtgatcacaggcgccacctcagggctgggcaaagaatgtgcaaaagtcttctatgctgcgggtgctaaactggtgctctgtggccggaatggtggggccctagaagagctcatcagagaactcaccgcttctcatgccaccaaggtgcagacacacaagccttacttggtgaccttcgacctcacagactctggggccatagttgcagcagcagctgagatcctgcagtgctttggctatgtcgacatacttgtcaacaatgctgggatcagctaccgtggtaccatcatggacaccacagtggatgtggacaagagggtcatggagacaaactactttggcccagttgctctaacgaaagcactcctgccctccatgatcaagaggaggcaaggccacattgtcgccatcagcagcatccagggcaagatgagcattccttttcgatcagcatatgcagcctccaagcacgcaacccaggctttctttgactgtctgcgtgccgagatggaacagtatgaaattgaggtgaccgtcatcagccccggctacatccacaccaacctctctgtaaatgccatcaccgcggatggatctaggtatggagttatggacaccaccacagcccagggccgaagccctgtggaggtggcccaggatgttcttgctgctgtggggaagaagaagaaagatgtgatcctggctgacttactgccttccttggctgtttatcttcgaactctggctcctgggctcttcttcagcctcatggcctccagggccagaaaagagcggaaatccaagaactcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - reticulocalbin 3, EF-hand calcium binding domain
- methylcrotonoyl-Coenzyme A carboxylase 2 (beta)
- reticulocalbin 1, EF-hand calcium binding domain
- EP300 interacting inhibitor of differentiation 3

Buy DHRS7B-dehydrogenase/reductase (SDR family) member 7B Gene now

Add to cart