EID3-EP300 interacting inhibitor of differentiation 3 Gene View larger

EID3-EP300 interacting inhibitor of differentiation 3 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EID3-EP300 interacting inhibitor of differentiation 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about EID3-EP300 interacting inhibitor of differentiation 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC027612
Product type: DNA & cDNA
Ncbi symbol: EID3
Origin species: Human
Product name: EID3-EP300 interacting inhibitor of differentiation 3 Gene
Size: 2ug
Accessions: BC027612
Gene id: 493861
Gene description: EP300 interacting inhibitor of differentiation 3
Synonyms: NS4EB; NSE4B; NSMCE4B; EP300-interacting inhibitor of differentiation 3; E1A-like inhibitor of differentiation 3; EID-1-like inhibitor of differentiation 3; EID-3; non-SMC element 4 homolog B; non-structural maintenance of chromosomes element 4 homolog B; testis tissue sperm-binding protein Li 96mP; EP300 interacting inhibitor of differentiation 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagatggatgtgtcagtgagggccgcgggctgctccgacgacctcagctctggggaggccgacgtagacccaaagctcctggagctcaccgctgacgaggagaagtgccgcagcatccgcaggcagtaccggcagctcatgtactgcgtgcggcagaaccgggaggacatcgtgagctcggcgaacaactccttaaccgaggctctggaggaagccaacgtcctctttgatggcgtgagccgaaccagagaagcagccctcgacgcccggtttcttgttatggcttctgatttgggtaaagaaaaggcaaagcagttaaactcagatatgaacttctttaatcagttagcattttgtgactttctgtttctgttcgtgggtctgaattggatggaaggcgatcctgacaagttgagtgattgtgatgatagcatagctctttccttctggaaggcaatagaaaaggaagcaacatcctggatggtaaaagctgagacattccattttgtttttggttcattcaagctagaacgttctgcaccaaagccccgacttgaacaccagaaaaaagttcgcaagatggaagaaaatggcaacatgcctacaaagttgcagaagttggacctgagtagttatccagaagcgacagaaaaaaacgtagaaaggattttgggattgttgcaaacctactttcgaaagtatcctgatactcctgtgtcctattttgagtttgtgattgatccaaactctttttctcgtactgtggagaatatattttatgtttcttttattgtaagagatggttttgcaagaataaggcttgatgaagacaggctgccaatattagagccgatgaatgttaaccaaatgggtgagggaaatgattccagttgccatggcaggaaacagggagttatatctttgactttacaggagtggaaaaacattgtggcagcttttgaaatttctgaggctatgattacatactcctcatactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - aspartate beta-hydroxylase domain containing 2
- family with sequence similarity 118, member A
- protein phosphatase 1K (PP2C domain containing)
- 1-acylglycerol-3-phosphate O-acyltransferase 3

Buy EID3-EP300 interacting inhibitor of differentiation 3 Gene now

Add to cart