FAM118A-family with sequence similarity 118, member A Gene View larger

FAM118A-family with sequence similarity 118, member A Gene

PTXBC013696

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM118A-family with sequence similarity 118, member A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM118A-family with sequence similarity 118, member A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013696
Product type: DNA & cDNA
Ncbi symbol: FAM118A
Origin species: Human
Product name: FAM118A-family with sequence similarity 118, member A Gene
Size: 2ug
Accessions: BC013696
Gene id: 55007
Gene description: family with sequence similarity 118, member A
Synonyms: protein FAM118A; C22orf8; bK268H5.C22.4; family with sequence similarity 118 member A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggattcagtggaaaagacaacaaatagaagtgaacaaaaatccagaaagtttttaaaaagcctcatccgcaaacagccccaggaactgctcctggttatcgggactggcgtcagcgcagcagtggcccccggaatccctgccctttgctcgtggagaagctgcatcgaggccgtcatcgaggctgcagagcagctggaggtgctgcaccccggagacgtcgccgagttccggaggaaagtgacaaaggaccgggacctgttggttgtcgcccatgatctgatccggaagatgtcacctcgcacaggcgatgccaagcccagcttcttccaggactgcctgatggaggtgtttgacgacctggagcagcacatccggagtcctctggtgctgcagtcgatcctcagcctgatggacagaggcgccatggtcctgaccaccaactatgacaacctgctggaggcctttggccggcggcagaacaagcccatggagtccctggacttgaaggacaagaccaaggtccttgaatgggcaagagggcacatgaagtacggcgtcctccacattcacggcctctacagggacccctgcggggtggtgctggacccatcggggtataaagacgtcactcaagacgcagaagtcatggaagtcctccagaacttataccgcaccaagtcctttctgtttgtgggctgtggggagacccttcatgatcagatattccaggccctctttctttactccgtgccgaataaggtggatttggagcactacatgcttgtgctgaaggagaatgaagaccatttctttaagcatcaggcagatatgcttctgcacggaatcaaagttgtatcctacggggactgttttgaccactttccaggatatgtgcaagaccttgccactcagatctgcaaacagcaaagcccagatgctgatcgcgtggacagcaccacattattgggtaatgcatgccaggactgtgcaaagaggaagttagaagagaatggaattgaagtttcaaaaaaacgcacacaatcagatactgatgatgctggagggtcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - protein phosphatase 1K (PP2C domain containing)
- 1-acylglycerol-3-phosphate O-acyltransferase 3
- eukaryotic translation initiation factor 2C, 2
- nuclear receptor subfamily 2, group E, member 1

Buy FAM118A-family with sequence similarity 118, member A Gene now

Add to cart